SZGR2

Summary ?

GeneID	867
Symbol	CBL
Synonyms	C-CBL\|CBL2\|FRA11B\|NSLL\|RNF55
Description	Cbl proto-oncogene, E3 ubiquitin protein ligase
Reference	MIM:165360\|HGNC:HGNC:1541\|Ensembl:ENSG00000110395\|HPRD:01320\|Vega:OTTHUMG00000166170
Gene type	protein-coding
Map location	11q23.3
Pascal p-value	0.141
Fetal beta	0.019
eGene	Cerebellum

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.006
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0043

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
STRA6	0.64	0.66
MMP2	0.63	0.71
EPHB4	0.63	0.71
SLC3A2	0.63	0.64
PDIA4	0.62	0.62
HTRA3	0.61	0.68
VASP	0.60	0.72
FSTL1	0.60	0.67
NID1	0.60	0.74
CMTM3	0.60	0.66

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ASPA	-0.42	-0.52
RBP7	-0.41	-0.56
OPALIN	-0.41	-0.56
EVI2A	-0.40	-0.52
MAL	-0.40	-0.49
RNASE1	-0.40	-0.47
CAPN3	-0.39	-0.57
SEPT4	-0.39	-0.50
DBNDD2	-0.39	-0.45
PLLP	-0.39	-0.46

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004871	signal transducer activity	IEA		-
GO:0003700	transcription factor activity	TAS		2030914
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	IPI		11891219
GO:0005525	GTP binding	IEA		-
GO:0004842	ubiquitin-protein ligase activity	EXP		12218189 \|12593796 \|16407834
GO:0004842	ubiquitin-protein ligase activity	TAS		15465819
GO:0016874	ligase activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007173	epidermal growth factor receptor signaling pathway	TAS		15465819
GO:0006511	ubiquitin-dependent protein catabolic process	IEA		-
GO:0007166	cell surface receptor linked signal transduction	TAS		15465819
GO:0007017	microtubule-based process	IEA		-
GO:0016567	protein ubiquitination	TAS		15465819
GO:0048260	positive regulation of receptor-mediated endocytosis	TAS		15465819
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	EXP		8621719 \|11823423 \|14505571
GO:0005874	microtubule	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0005886	plasma membrane	EXP		10567358 \|11894095 \|12218189 \|12593796 \|15475003 \|15962011 \|16407834
GO:0005886	plasma membrane	IDA		15465819

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	-	HPRD,BioGRID	12475393
ARHGEF7	BETA-PIX \| COOL1 \| DKFZp686C12170 \| DKFZp761K1021 \| KIAA0142 \| KIAA0412 \| Nbla10314 \| P50 \| P50BP \| P85 \| P85COOL1 \| P85SPR \| PAK3 \| PIXB	Rho guanine nucleotide exchange factor (GEF) 7	Two-hybrid	BioGRID	12935897
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	Co-purification	BioGRID	8641358
BLK	MGC10442	B lymphoid tyrosine kinase	-	HPRD	8083187
BTK	AGMX1 \| AT \| ATK \| BPK \| IMD1 \| MGC126261 \| MGC126262 \| PSCTK1 \| XLA	Bruton agammaglobulinemia tyrosine kinase	-	HPRD,BioGRID	7629518 \|10427990
CD19	B4 \| MGC12802	CD19 molecule	-	HPRD	9178909
CD2AP	CMS \| DKFZp586H0519	CD2-associated protein	CMS interacts with Cbl. This interaction was modeled on a demonstrated interaction between CMS from an unspecified species and human Cbl.	BIND	15128873
CD2AP	CMS \| DKFZp586H0519	CD2-associated protein	-	HPRD,BioGRID	11067845
CD5	LEU1 \| T1	CD5 molecule	-	HPRD,BioGRID	9603468
CDKL2	KKIAMRE \| P56	cyclin-dependent kinase-like 2 (CDC2-related kinase)	-	HPRD	7721825
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	Affinity Capture-Western	BioGRID	9178909 \|9461587
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	-	HPRD	8621483 \|8662998
CRKL	-	v-crk sarcoma virus CT10 oncogene homolog (avian)-like	Affinity Capture-Western Reconstituted Complex	BioGRID	9092574 \|9162067 \|9344843 \|9461587 \|9590251 \|9820532 \|10204582 \|10907644 \|11133830 \|12244174
CRKL	-	v-crk sarcoma virus CT10 oncogene homolog (avian)-like	-	HPRD	9162067 \|9590251 \|12244174
CSF1R	C-FMS \| CD115 \| CSFR \| FIM2 \| FMS	colony stimulating factor 1 receptor	-	HPRD,BioGRID	11847211
CSK	MGC117393	c-src tyrosine kinase	-	HPRD,BioGRID	11149930
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	Affinity Capture-Western	BioGRID	10086340 \|12061819
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD	8662998
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	An unspecified isoform of EGFR interacts with CBL.	BIND	15735736
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	c-Cbl ubiquitinates an unspecified isoform of EGFR. This interaction was modeled on a demonstrated interaction between c-Cbl and EGFR, both from an unspecified species.	BIND	12234920
EPHB6	HEP \| MGC129910 \| MGC129911	EPH receptor B6	-	HPRD	11713248
FGR	FLJ43153 \| MGC75096 \| SRC2 \| c-fgr \| c-src2 \| p55c-fgr \| p58c-fgr	Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog	-	HPRD,BioGRID	12435267
FLOT1	-	flotillin 1	-	HPRD,BioGRID	11001060
FRS2	FRS2A \| FRS2alpha \| SNT \| SNT-1 \| SNT1	fibroblast growth factor receptor substrate 2	-	HPRD,BioGRID	11997436
FYN	MGC45350 \| SLK \| SYN	FYN oncogene related to SRC, FGR, YES	-	HPRD,BioGRID	9535867
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Grb2 interacts with Cbl.	BIND	15782196
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	c-Cbl interacts with Grb2. This interaction was modeled on a demonstrated interaction between human c-Cbl and Grb2 from an unspecified species.	BIND	11053437
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	8083187 \|9108392 \|9174058 \|9178909 \|9367879 \|9461587 \|9872323 \|10086340 \|10204582 \|10570290 \|11964172 \|11997436
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD	9108392 \|9178909 \|11133830 \|11964172
HCK	JTK9	hemopoietic cell kinase	-	HPRD,BioGRID	10092522
INPPL1	SHIP2	inositol polyphosphate phosphatase-like 1	-	HPRD,BioGRID	12504111
ITK	EMT \| LYK \| MGC126257 \| MGC126258 \| PSCTK2	IL2-inducible T-cell kinase	-	HPRD,BioGRID	8810341
KRT18	CYK18 \| K18	keratin 18	c-Cbl interacts with Keratin 18.	BIND	9367879
KRT18	CYK18 \| K18	keratin 18	-	HPRD,BioGRID	9367879
LCK	YT16 \| p56lck \| pp58lck	lymphocyte-specific protein tyrosine kinase	-	HPRD,BioGRID	9178909 \|11741956 \|11904433
LCP2	SLP-76 \| SLP76	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	-	HPRD,BioGRID	10204582
LTK	TYK1	leukocyte receptor tyrosine kinase	-	HPRD,BioGRID	9223670
LYN	FLJ26625 \| JTK8	v-yes-1 Yamaguchi sarcoma viral related oncogene homolog	Affinity Capture-Western	BioGRID	12244174
LYN	FLJ26625 \| JTK8	v-yes-1 Yamaguchi sarcoma viral related oncogene homolog	-	HPRD	12149655
MET	AUTS9 \| HGFR \| RCCP2 \| c-Met	met proto-oncogene (hepatocyte growth factor receptor)	Met interacts with Cbl.	BIND	11894096
MET	AUTS9 \| HGFR \| RCCP2 \| c-Met	met proto-oncogene (hepatocyte growth factor receptor)	-	HPRD,BioGRID	11894096
MYO1C	FLJ23903 \| MMI-beta \| MMIb \| NMI \| myr2	myosin IC	Two-hybrid	BioGRID	9367879
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	Affinity Capture-Western	BioGRID	10204582 \|11494134
OSTF1	FLJ20559 \| OSF \| SH3P2 \| bA235O14.1	osteoclast stimulating factor 1	Cbl interacts with SH3P2.	BIND	15135048
PDGFRA	CD140A \| MGC74795 \| PDGFR2 \| Rhe-PDGFRA	platelet-derived growth factor receptor, alpha polypeptide	Affinity Capture-Western Reconstituted Complex	BioGRID	9234717
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	c-Cbl interacts with and ubiquitinates PDGF-R-beta. This interaction was modeled on a demonstrated interaction between human c-Cbl and PDGF-R-beta from an unspecified species.	BIND	10514377
PIK3CA	MGC142161 \| MGC142163 \| PI3K \| p110-alpha	phosphoinositide-3-kinase, catalytic, alpha polypeptide	Co-purification	BioGRID	8641358
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	Affinity Capture-Western	BioGRID	9461587 \|9918857
PIK3R2	P85B \| p85 \| p85-BETA	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	-	HPRD,BioGRID	7629144
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	-	HPRD,BioGRID	9712732 \|12061819
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	-	HPRD,BioGRID	11149930
PTPN22	LYP \| Lyp1 \| Lyp2 \| PEP \| PTPN8	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	-	HPRD	10068674
PTPN6	HCP \| HCPH \| HPTP1C \| PTP-1C \| SH-PTP1 \| SHP-1 \| SHP-1L \| SHP1	protein tyrosine phosphatase, non-receptor type 6	-	HPRD,BioGRID	12176909
PXN	FLJ16691	paxillin	Co-purification	BioGRID	8641358
RET	CDHF12 \| HSCR1 \| MEN2A \| MEN2B \| MTC1 \| PTC \| RET-ELE1 \| RET51	ret proto-oncogene	-	HPRD	12727845
SH2B2	APS	SH2B adaptor protein 2	Reconstituted Complex	BioGRID	10374881
SH3BP2	3BP2 \| CRBM \| CRPM \| FLJ42079 \| RES4-23	SH3-domain binding protein 2	Reconstituted Complex	BioGRID	9846481
SH3GL2	CNSA2 \| EEN-B1 \| FLJ20276 \| FLJ25015 \| SH3D2A \| SH3P4	SH3-domain GRB2-like 2	-	HPRD	11894096
SH3GL2	CNSA2 \| EEN-B1 \| FLJ20276 \| FLJ25015 \| SH3D2A \| SH3P4	SH3-domain GRB2-like 2	Affinity Capture-Western	BioGRID	11894095
SH3GL3	CNSA3 \| EEN-2B-L3 \| EEN-B2 \| HsT19371 \| SH3D2C \| SH3P13	SH3-domain GRB2-like 3	-	HPRD,BioGRID	11894096
SH3KBP1	CIN85 \| GIG10 \| MIG18	SH3-domain kinase binding protein 1	-	HPRD,BioGRID	11894095
SH3KBP1	CIN85 \| GIG10 \| MIG18	SH3-domain kinase binding protein 1	CIN85 interacts with Cbl.	BIND	11894095
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD,BioGRID	10570290
SLA	SLA1 \| SLAP	Src-like-adaptor	-	HPRD,BioGRID	10449770
SLA2	C20orf156 \| FLJ21992 \| MGC49845 \| SLAP-2 \| SLAP2	Src-like-adaptor 2	-	HPRD,BioGRID	11891219 \|12024036
SORBS1	CAP \| DKFZp451C066 \| DKFZp586P1422 \| FLAF2 \| FLJ12406 \| KIAA1296 \| R85FL \| SH3D5 \| SH3P12 \| SORB1	sorbin and SH3 domain containing 1	-	HPRD	11001060
SORBS1	CAP \| DKFZp451C066 \| DKFZp586P1422 \| FLAF2 \| FLJ12406 \| KIAA1296 \| R85FL \| SH3D5 \| SH3P12 \| SORB1	sorbin and SH3 domain containing 1	Affinity Capture-Western	BioGRID	12504111 \|15128873
SORBS1	CAP \| DKFZp451C066 \| DKFZp586P1422 \| FLAF2 \| FLJ12406 \| KIAA1296 \| R85FL \| SH3D5 \| SH3P12 \| SORB1	sorbin and SH3 domain containing 1	An unspecified isoform of CAP interacts with Cbl. This interaction was modeled on a demonstrated interaction between CAP from an unspecified species and human Cbl.	BIND	15128873
SORBS2	ARGBP2 \| FLJ93447 \| KIAA0777 \| PRO0618	sorbin and SH3 domain containing 2	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	12475393 \|15128873
SORBS2	ARGBP2 \| FLJ93447 \| KIAA0777 \| PRO0618	sorbin and SH3 domain containing 2	ArgBP2 interacts with Cbl.	BIND	15128873
SORBS2	ARGBP2 \| FLJ93447 \| KIAA0777 \| PRO0618	sorbin and SH3 domain containing 2	ArgBP2-A interacts with Cbl.	BIND	12475393
SPRY2	MGC23039 \| hSPRY2	sprouty homolog 2 (Drosophila)	-	HPRD,BioGRID	11053437 \|12234920
SPRY2	MGC23039 \| hSPRY2	sprouty homolog 2 (Drosophila)	c-Cbl interacts with hSpry2. This interaction was modeled on a demonstrated interaction between c-Cbl from an unspecified species and human hSpry2.	BIND	12234920
SPRY2	MGC23039 \| hSPRY2	sprouty homolog 2 (Drosophila)	SPRY2 interacts with c-Cbl.	BIND	11053437
SPRY2	MGC23039 \| hSPRY2	sprouty homolog 2 (Drosophila)	hSpry2 interacts with c-Cbl.	BIND	12815057
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD	8635998
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	Cbl interacts with Src. This interaction was modeled on a demonstrated interaction between human Cbl and Src from unspecified species.	BIND	15135048
SYK	DKFZp313N1010 \| FLJ25043 \| FLJ37489	spleen tyrosine kinase	Affinity Capture-Western Reconstituted Complex	BioGRID	9857068 \|11331248 \|12435267
SYK	DKFZp313N1010 \| FLJ25043 \| FLJ37489	spleen tyrosine kinase	-	HPRD	9857068 \|10540342 \|11133830
TLN1	ILWEQ \| KIAA1027 \| TLN	talin 1	Co-purification	BioGRID	8641358
TYK2	JTK1	tyrosine kinase 2	Affinity Capture-Western	BioGRID	8780698
UBASH3B	KIAA1959 \| MGC15437 \| STS-1 \| STS1 \| p70	ubiquitin associated and SH3 domain containing, B	-	HPRD	15159412
UBE2D2	E2(17)KB2 \| PUBC1 \| UBC4 \| UBC4/5 \| UBCH5B	ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)	-	HPRD,BioGRID	10514377
UBE2D2	E2(17)KB2 \| PUBC1 \| UBC4 \| UBC4/5 \| UBCH5B	ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)	c-Cbl interacts with Ubc4.	BIND	10514377
UBE2G1	E217K \| UBC7 \| UBE2G	ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast)	-	HPRD	11032556
UBE2G2	UBC7	ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)	-	HPRD	11032556
UBE2L3	E2-F1 \| L-UBC \| UBCH7 \| UbcM4	ubiquitin-conjugating enzyme E2L 3	Affinity Capture-Western Co-crystal Structure Reconstituted Complex	BioGRID	10531381 \|10966114 \|12234920
UBE2L3	E2-F1 \| L-UBC \| UBCH7 \| UbcM4	ubiquitin-conjugating enzyme E2L 3	-	HPRD	10531381 \|10966114 \|11278816
UBE2L3	E2-F1 \| L-UBC \| UBCH7 \| UbcM4	ubiquitin-conjugating enzyme E2L 3	c-Cbl interacts with an unspecified isoform of UbcH7. This interaction was modeled on a demonstrated interaction between c-Cbl from an unspecified species and human UbcH7.	BIND	12234920
VAV1	VAV	vav 1 guanine nucleotide exchange factor	-	HPRD	9200440 \|11133830
VAV1	VAV	vav 1 guanine nucleotide exchange factor	Affinity Capture-Western Far Western Reconstituted Complex	BioGRID	9200440 \|11331248
VAV2	-	vav 2 guanine nucleotide exchange factor	-	HPRD	11313921
YWHAB	GW128 \| HS1 \| KCIP-1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide	c-Cbl interacts with 14-3-3-beta.	BIND	9367879
YWHAB	GW128 \| HS1 \| KCIP-1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9367879
YWHAQ	14-3-3 \| 1C5 \| HS1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide	-	HPRD,BioGRID	8663231 \|11024037
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	Two-hybrid	BioGRID	9367879
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	c-Cbl interacts with 14-3-3-zeta.	BIND	9367879
ZAP70	FLJ17670 \| FLJ17679 \| SRK \| STD \| TZK \| ZAP-70	zeta-chain (TCR) associated protein kinase 70kDa	Affinity Capture-Western Co-crystal Structure	BioGRID	8798643 \|10078535

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG UBIQUITIN MEDIATED PROTEOLYSIS	138	98	All SZGR 2.0 genes in this pathway
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
KEGG JAK STAT SIGNALING PATHWAY	155	105	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG INSULIN SIGNALING PATHWAY	137	103	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
BIOCARTA CBL PATHWAY	13	10	All SZGR 2.0 genes in this pathway
BIOCARTA IL2RB PATHWAY	38	26	All SZGR 2.0 genes in this pathway
BIOCARTA SPRY PATHWAY	18	15	All SZGR 2.0 genes in this pathway
SIG INSULIN RECEPTOR PATHWAY IN CARDIAC MYOCYTES	51	41	All SZGR 2.0 genes in this pathway
ST T CELL SIGNAL TRANSDUCTION	45	33	All SZGR 2.0 genes in this pathway
PID FCER1 PATHWAY	62	43	All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID NOTCH PATHWAY	59	49	All SZGR 2.0 genes in this pathway
PID IL4 2PATHWAY	65	43	All SZGR 2.0 genes in this pathway
PID TCR PATHWAY	66	51	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID REELIN PATHWAY	29	29	All SZGR 2.0 genes in this pathway
PID CDC42 PATHWAY	70	51	All SZGR 2.0 genes in this pathway
PID CD8 TCR PATHWAY	53	42	All SZGR 2.0 genes in this pathway
PID AVB3 INTEGRIN PATHWAY	75	53	All SZGR 2.0 genes in this pathway
PID IFNG PATHWAY	40	34	All SZGR 2.0 genes in this pathway
PID EPHA FWDPATHWAY	34	29	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID IL8 CXCR2 PATHWAY	34	26	All SZGR 2.0 genes in this pathway
PID ERBB1 INTERNALIZATION PATHWAY	41	35	All SZGR 2.0 genes in this pathway
PID VEGFR1 PATHWAY	26	23	All SZGR 2.0 genes in this pathway
PID KIT PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID EPO PATHWAY	34	29	All SZGR 2.0 genes in this pathway
PID VEGFR1 2 PATHWAY	69	57	All SZGR 2.0 genes in this pathway
PID IL8 CXCR1 PATHWAY	28	19	All SZGR 2.0 genes in this pathway
PID EPHA2 FWD PATHWAY	19	16	All SZGR 2.0 genes in this pathway
PID FGF PATHWAY	55	37	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY SCF KIT	78	59	All SZGR 2.0 genes in this pathway
REACTOME SPRY REGULATION OF FGF SIGNALING	14	9	All SZGR 2.0 genes in this pathway
REACTOME NEGATIVE REGULATION OF FGFR SIGNALING	37	24	All SZGR 2.0 genes in this pathway
REACTOME REGULATION OF KIT SIGNALING	17	10	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY CONSTITUTIVELY ACTIVE EGFR	18	13	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY EGFR IN CANCER	109	80	All SZGR 2.0 genes in this pathway
REACTOME ANTIGEN ACTIVATES B CELL RECEPTOR LEADING TO GENERATION OF SECOND MESSENGERS	29	24	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY THE B CELL RECEPTOR BCR	126	90	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR IN DISEASE	127	88	All SZGR 2.0 genes in this pathway
REACTOME EGFR DOWNREGULATION	25	14	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ILS	107	86	All SZGR 2.0 genes in this pathway
REACTOME REGULATION OF SIGNALING BY CBL	18	16	All SZGR 2.0 genes in this pathway
REACTOME IL 3 5 AND GM CSF SIGNALING	43	34	All SZGR 2.0 genes in this pathway
REACTOME IL 6 SIGNALING	11	9	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ADAPTIVE IMMUNE SYSTEM	539	350	All SZGR 2.0 genes in this pathway
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM	270	204	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR	112	80	All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 TARGETS DN	158	102	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 23	24	13	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN	357	212	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER BRCA1 VS BRCA2	163	113	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
LEE RECENT THYMIC EMIGRANT	227	128	All SZGR 2.0 genes in this pathway
FONTAINE PAPILLARY THYROID CARCINOMA DN	80	53	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN	106	77	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	3440	3447	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
				hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-1/206	914	921	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-101	763	769	m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-124/506	7186	7192	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-133	3362	3368	m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	3362	3368	m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-141/200a	8015	8022	1A,m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	8015	8022	1A,m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-150	3871	3877	1A	hsa-miR-150	UCUCCCAACCCUUGUACCAGUG
miR-192/215	985	991	m8	hsa-miR-192	CUGACCUAUGAAUUGACAGCC
miR-192/215	985	991	m8	hsa-miR-215	AUGACCUAUGAAUUGACAGAC
miR-199	808	814	m8	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	808	814	m8	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC
miR-214	7025	7032	1A,m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-214	7025	7032	1A,m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-218	450	456	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-22	7051	7058	1A,m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-221/222	8360	8366	1A	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	8360	8366	1A	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-30-3p	7157	7164	1A,m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	7157	7164	1A,m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-320	8177	8183	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-330	3857	3863	1A	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-338	7619	7625	1A	hsa-miR-338^brain	UCCAGCAUCAGUGAUUUUGUUGA
miR-374	404	410	1A	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-381	8007	8013	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-410	7112	7118	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-495	734	740	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-542-3p	4125	4131	m8	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA
miR-543	8251	8257	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-9	6138	6144	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CBL