Gene Page: BECN1
Summary ?
| GeneID | 8678 |
| Symbol | BECN1 |
| Synonyms | ATG6|VPS30|beclin1 |
| Description | beclin 1, autophagy related |
| Reference | MIM:604378|HGNC:HGNC:1034|Ensembl:ENSG00000126581|HPRD:05087|Vega:OTTHUMG00000180653 |
| Gene type | protein-coding |
| Map location | 17q21 |
| Pascal p-value | 0.141 |
| Sherlock p-value | 0.357 |
| eGene | Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Expression | Meta-analysis of gene expression | P value: 1.759 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 17589504 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006968 | cellular defense response | TAS | 9765397 | |
| GO:0009615 | response to virus | IEA | - | |
| GO:0006916 | anti-apoptosis | TAS | 9765397 | |
| GO:0006914 | autophagy | IEA | - | |
| GO:0016239 | positive regulation of macroautophagy | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005802 | trans-Golgi network | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016023 | cytoplasmic membrane-bounded vesicle | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG REGULATION OF AUTOPHAGY | 35 | 30 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| MISSIAGLIA REGULATED BY METHYLATION UP | 126 | 78 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN | 161 | 105 | All SZGR 2.0 genes in this pathway |
| AGUIRRE PANCREATIC CANCER COPY NUMBER UP | 298 | 174 | All SZGR 2.0 genes in this pathway |
| HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
| KYNG WERNER SYNDROM AND NORMAL AGING DN | 225 | 124 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11 | 103 | 68 | All SZGR 2.0 genes in this pathway |
| SASSON RESPONSE TO GONADOTROPHINS DN | 87 | 66 | All SZGR 2.0 genes in this pathway |
| SASSON RESPONSE TO FORSKOLIN UP | 90 | 58 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
| IKEDA MIR30 TARGETS UP | 116 | 87 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-142-5p | 136 | 142 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| miR-30-5p | 98 | 105 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.