SZGR2

Summary ?

GeneID	868
Symbol	CBLB
Synonyms	Cbl-b\|Nbla00127\|RNF56
Description	Cbl proto-oncogene B, E3 ubiquitin protein ligase
Reference	MIM:604491\|HGNC:HGNC:1542\|Ensembl:ENSG00000114423\|HPRD:05136\|Vega:OTTHUMG00000150654
Gene type	protein-coding
Map location	3q13.11
Pascal p-value	0.033
Sherlock p-value	0.612
Fetal beta	2.144
DMG	1 (# studies)
eGene	Cerebellum Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.04359
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.04047

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg17468841	3	105588020	CBLB		-0.026	0.25	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs17392743	chr1	54764240	CBLB	868	0.15	trans
rs17572651	chr1	218943612	CBLB	868	0.07	trans
rs16829545	chr2	151977407	CBLB	868	4.454E-16	trans
rs3845734	chr2	171125572	CBLB	868	0.11	trans
rs7584986	chr2	184111432	CBLB	868	4.573E-5	trans
rs9810143	chr3	5060209	CBLB	868	0.18	trans
rs6797307	chr3	8601563	CBLB	868	0.17	trans
rs16860529	chr3	185900368	CBLB	868	0.06	trans
rs7727026	chr5	3456152	CBLB	868	0.1	trans
rs2914204	chr5	3470913	CBLB	868	0.16	trans
rs13360496		0	CBLB	868	0.09	trans
rs16890367	chr6	38078448	CBLB	868	0.05	trans
rs11139334	chr9	84209393	CBLB	868	0	trans
rs3765543	chr9	134458323	CBLB	868	0.15	trans
rs2393316	chr10	59333070	CBLB	868	0.02	trans
rs16955618	chr15	29937543	CBLB	868	1.128E-22	trans
rs11873184	chr18	1584081	CBLB	868	0.09	trans
rs7274477	chr20	1676942	CBLB	868	0.13	trans
rs1041786	chr21	22617710	CBLB	868	0	trans
rs16990575	chrX	32691327	CBLB	868	0.07	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004871	signal transducer activity	IEA		-
GO:0005509	calcium ion binding	IEA		-
GO:0005515	protein binding	TAS		7784085
GO:0016874	ligase activity	IEA		-
GO:0008270	zinc ion binding	TAS		7784085
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006511	ubiquitin-dependent protein catabolic process	IEA		-
GO:0007242	intracellular signaling cascade	IEA		-
GO:0007166	cell surface receptor linked signal transduction	IEA		-
GO:0006607	NLS-bearing substrate import into nucleus	TAS		7784085
GO:0006955	immune response	IEA		-
GO:0042110	T cell activation	IEA		-
GO:0050860	negative regulation of T cell receptor signaling pathway	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BLNK	BASH \| BLNK-S \| LY57 \| MGC111051 \| SLP-65 \| SLP65	B-cell linker	-	HPRD	12093870
BTK	AGMX1 \| AT \| ATK \| BPK \| IMD1 \| MGC126261 \| MGC126262 \| PSCTK1 \| XLA	Bruton agammaglobulinemia tyrosine kinase	Affinity Capture-Western	BioGRID	12093870
CRKL	-	v-crk sarcoma virus CT10 oncogene homolog (avian)-like	-	HPRD,BioGRID	10022120
CRY1	PHLL1	cryptochrome 1 (photolyase-like)	Two-hybrid	BioGRID	16189514
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD,BioGRID	10086340
FLT3	CD135 \| FLK2 \| STK1	fms-related tyrosine kinase 3	-	HPRD	9614102
GORASP2	DKFZp434D156 \| FLJ13139 \| GOLPH6 \| GRASP55 \| GRS2 \| p59	golgi reassembly stacking protein 2, 55kDa	Two-hybrid	BioGRID	16189514
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD,BioGRID	10086340
KIT	C-Kit \| CD117 \| PBT \| SCFR	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	Affinity Capture-Western	BioGRID	12177062
NCK2	GRB4 \| NCKbeta	NCK adaptor protein 2	Two-hybrid	BioGRID	16189514
NEDD4	KIAA0093 \| MGC176705 \| NEDD4-1 \| RPF1	neural precursor cell expressed, developmentally down-regulated 4	-	HPRD,BioGRID	12907674
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	Affinity Capture-Western	BioGRID	9614102
PLCG2	-	phospholipase C, gamma 2 (phosphatidylinositol-specific)	-	HPRD,BioGRID	12093870
SH3KBP1	CIN85 \| GIG10 \| MIG18	SH3-domain kinase binding protein 1	-	HPRD,BioGRID	12218189
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD,BioGRID	9614102
SORBS3	SCAM-1 \| SCAM1 \| SH3D4 \| VINEXIN	sorbin and SH3 domain containing 3	Two-hybrid	BioGRID	16189514
SPRY2	MGC23039 \| hSPRY2	sprouty homolog 2 (Drosophila)	SPRY2 interacts with Cbl-b.	BIND	11053437
VAV1	VAV	vav 1 guanine nucleotide exchange factor	-	HPRD,BioGRID	11857085
ZAP70	FLJ17670 \| FLJ17679 \| SRK \| STD \| TZK \| ZAP-70	zeta-chain (TCR) associated protein kinase 70kDa	-	HPRD,BioGRID	10074432

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG UBIQUITIN MEDIATED PROTEOLYSIS	138	98	All SZGR 2.0 genes in this pathway
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
KEGG JAK STAT SIGNALING PATHWAY	155	105	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG INSULIN SIGNALING PATHWAY	137	103	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
PID FCER1 PATHWAY	62	43	All SZGR 2.0 genes in this pathway
PID CD40 PATHWAY	31	26	All SZGR 2.0 genes in this pathway
PID NFAT TFPATHWAY	47	39	All SZGR 2.0 genes in this pathway
PID ERBB1 INTERNALIZATION PATHWAY	41	35	All SZGR 2.0 genes in this pathway
REACTOME ANTIGEN ACTIVATES B CELL RECEPTOR LEADING TO GENERATION OF SECOND MESSENGERS	29	24	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY THE B CELL RECEPTOR BCR	126	90	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ADAPTIVE IMMUNE SYSTEM	539	350	All SZGR 2.0 genes in this pathway
REACTOME CLASS I MHC MEDIATED ANTIGEN PROCESSING PRESENTATION	251	156	All SZGR 2.0 genes in this pathway
REACTOME ANTIGEN PROCESSING UBIQUITINATION PROTEASOME DEGRADATION	212	129	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE UP	108	67	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP	177	110	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN	240	171	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP	145	91	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION UP	38	25	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE UP	203	130	All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION UP	87	67	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 AND CD2 UP	89	51	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR DN	56	37	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
XU GH1 EXOGENOUS TARGETS UP	85	50	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP	178	111	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR UP	101	69	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
XU GH1 AUTOCRINE TARGETS UP	268	157	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP	280	183	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR DN	160	101	All SZGR 2.0 genes in this pathway
MARCHINI TRABECTEDIN RESISTANCE DN	49	34	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP	196	137	All SZGR 2.0 genes in this pathway
AMUNDSON GAMMA RADIATION RESISTANCE	20	14	All SZGR 2.0 genes in this pathway
COATES MACROPHAGE M1 VS M2 DN	78	44	All SZGR 2.0 genes in this pathway
HUANG FOXA2 TARGETS UP	45	28	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP	973	570	All SZGR 2.0 genes in this pathway
CHUNG BLISTER CYTOTOXICITY UP	134	84	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP	245	159	All SZGR 2.0 genes in this pathway
RUIZ TNC TARGETS UP	153	107	All SZGR 2.0 genes in this pathway
KOBAYASHI EGFR SIGNALING 24HR UP	101	65	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 4	110	66	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 36HR	152	88	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-135	201	207	1A	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	201	207	1A	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-181	643	650	1A,m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-27	273	279	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	273	279	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-5p	291	298	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CBLB