Gene Page: B3GALT1
Summary ?
| GeneID | 8708 |
| Symbol | B3GALT1 |
| Synonyms | beta3Gal-T1 |
| Description | Beta-1,3-galactosyltransferase 1 |
| Reference | MIM:603093|HGNC:HGNC:916|HPRD:04369| |
| Gene type | protein-coding |
| Map location | 2q24.3 |
| Pascal p-value | 0.008 |
| eGene | Cerebellar Hemisphere Cerebellum Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C21orf62 | 0.48 | 0.16 |
| TP53AIP1 | 0.42 | 0.25 |
| VCAM1 | 0.42 | 0.16 |
| POU2F1 | 0.42 | 0.12 |
| FCHSD1 | 0.42 | 0.21 |
| ELN | 0.42 | 0.21 |
| CDC42BPG | 0.42 | 0.15 |
| LRRC36 | 0.42 | 0.22 |
| ZNF474 | 0.42 | 0.07 |
| SHFM1 | 0.41 | 0.26 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.33 | -0.21 | -0.18 |
| AF347015.15 | -0.21 | -0.19 |
| MT-CYB | -0.21 | -0.19 |
| AF347015.27 | -0.20 | -0.18 |
| MT-CO2 | -0.20 | -0.16 |
| AF347015.8 | -0.20 | -0.17 |
| AF347015.2 | -0.20 | -0.14 |
| AF347015.31 | -0.19 | -0.16 |
| AF347015.26 | -0.19 | -0.16 |
| AF347015.9 | -0.19 | -0.18 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008378 | galactosyltransferase activity | IEA | - | |
| GO:0016757 | transferase activity, transferring glycosyl groups | IEA | - | |
| GO:0008499 | UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity | NAS | - | |
| GO:0030145 | manganese ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0030259 | lipid glycosylation | NAS | - | |
| GO:0006486 | protein amino acid glycosylation | NAS | - | |
| GO:0009312 | oligosaccharide biosynthetic process | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | NAS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG GLYCOSPHINGOLIPID BIOSYNTHESIS LACTO AND NEOLACTO SERIES | 26 | 19 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS C UP | 170 | 114 | All SZGR 2.0 genes in this pathway |
| WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
| LABBE WNT3A TARGETS DN | 97 | 53 | All SZGR 2.0 genes in this pathway |
| YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
| DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
| VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
| OHGUCHI LIVER HNF4A TARGETS DN | 149 | 85 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-378 | 406 | 413 | 1A,m8 | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.