Gene Page: TNFSF13
Summary ?
| GeneID | 8741 |
| Symbol | TNFSF13 |
| Synonyms | APRIL|CD256|TALL-2|TALL2|TNLG7B|TRDL-1|UNQ383/PRO715|ZTNF2 |
| Description | tumor necrosis factor superfamily member 13 |
| Reference | MIM:604472|HGNC:HGNC:11928|Ensembl:ENSG00000161955|Vega:OTTHUMG00000108145 |
| Gene type | protein-coding |
| Map location | 17p13.1 |
| Pascal p-value | 0.255 |
| Sherlock p-value | 0.079 |
| Fetal beta | -1.306 |
| eGene | Cortex |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Expression | Meta-analysis of gene expression | P value: 1.943 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| NCAPH2 | 0.85 | 0.86 |
| INO80E | 0.83 | 0.81 |
| AC010422.1 | 0.83 | 0.84 |
| NTHL1 | 0.83 | 0.83 |
| STK25 | 0.83 | 0.85 |
| VPS28 | 0.82 | 0.85 |
| RNF25 | 0.82 | 0.83 |
| DDX41 | 0.82 | 0.83 |
| MPND | 0.82 | 0.82 |
| NOL12 | 0.81 | 0.83 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.67 | -0.68 |
| AF347015.33 | -0.67 | -0.69 |
| MT-CYB | -0.66 | -0.69 |
| AF347015.2 | -0.66 | -0.69 |
| MT-CO2 | -0.66 | -0.66 |
| AF347015.8 | -0.66 | -0.69 |
| AF347015.27 | -0.65 | -0.69 |
| AF347015.26 | -0.65 | -0.71 |
| AF347015.15 | -0.65 | -0.68 |
| MT-ATP8 | -0.57 | -0.69 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005125 | cytokine activity | IEA | - | |
| GO:0005164 | tumor necrosis factor receptor binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007165 | signal transduction | TAS | 9743536 | |
| GO:0008284 | positive regulation of cell proliferation | TAS | 9743536 | |
| GO:0006955 | immune response | IEA | - | |
| GO:0048298 | positive regulation of isotype switching to IgA isotypes | IDA | 14988498 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005615 | extracellular space | IEA | - | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION | 267 | 161 | All SZGR 2.0 genes in this pathway |
| KEGG INTESTINAL IMMUNE NETWORK FOR IGA PRODUCTION | 48 | 36 | All SZGR 2.0 genes in this pathway |
| BIOCARTA TALL1 PATHWAY | 15 | 15 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF MRNA | 284 | 128 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF RNA | 330 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME REGULATION OF MRNA STABILITY BY PROTEINS THAT BIND AU RICH ELEMENTS | 84 | 50 | All SZGR 2.0 genes in this pathway |
| CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN | 187 | 115 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| BARIS THYROID CANCER DN | 59 | 45 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 TTD UP | 64 | 39 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM2 | 153 | 102 | All SZGR 2.0 genes in this pathway |
| SHIN B CELL LYMPHOMA CLUSTER 3 | 28 | 23 | All SZGR 2.0 genes in this pathway |
| ROSS AML WITH CBFB MYH11 FUSION | 52 | 32 | All SZGR 2.0 genes in this pathway |
| WANG IMMORTALIZED BY HOXA9 AND MEIS1 UP | 31 | 24 | All SZGR 2.0 genes in this pathway |
| MEDINA SMARCA4 TARGETS | 44 | 29 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER WITH H3K9ME3 UP | 141 | 75 | All SZGR 2.0 genes in this pathway |
| RAY TUMORIGENESIS BY ERBB2 CDC25A UP | 104 | 57 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 LCP WITH H3K4ME3 | 162 | 80 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN IPS LCP WITH H3K4ME3 | 174 | 100 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES LCP WITH H3K4ME3 | 142 | 80 | All SZGR 2.0 genes in this pathway |
| WANG METASTASIS OF BREAST CANCER ESR1 DN | 30 | 18 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
| DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| NABA SECRETED FACTORS | 344 | 197 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-199 | 110 | 116 | 1A | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.