Gene Page: ANKRD13A
Summary ?
| GeneID | 88455 |
| Symbol | ANKRD13A |
| Synonyms | ANKRD13|NY-REN-25 |
| Description | ankyrin repeat domain 13A |
| Reference | MIM:615123|HGNC:HGNC:21268|Ensembl:ENSG00000076513|HPRD:12458|Vega:OTTHUMG00000169314 |
| Gene type | protein-coding |
| Map location | 12q24.11 |
| Pascal p-value | 5.303E-5 |
| Sherlock p-value | 0.491 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Expression | Meta-analysis of gene expression | P value: 1.593 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs246085 | chr12 | 109558196 | ANKRD13A | 88455 | 0.14 | cis | ||
| rs6829546 | chr4 | 12587664 | ANKRD13A | 88455 | 0.14 | trans | ||
| rs6448932 | chr4 | 12595798 | ANKRD13A | 88455 | 0.03 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
| PASQUALUCCI LYMPHOMA BY GC STAGE DN | 165 | 104 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS DN | 210 | 128 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS GROWING | 243 | 155 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| FOSTER KDM1A TARGETS DN | 211 | 119 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 665 | 671 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA | ||||
| miR-124/506 | 658 | 664 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-137 | 1144 | 1150 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-204/211 | 1023 | 1030 | 1A,m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
| hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
| hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU | ||||
| hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
| miR-22 | 802 | 808 | 1A | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
| hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU | ||||
| miR-320 | 289 | 296 | 1A,m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
| miR-500 | 137 | 143 | m8 | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
| miR-539 | 1175 | 1181 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.