SZGR2

Summary ?

GeneID	8851
Symbol	CDK5R1
Synonyms	CDK5P35\|CDK5R\|NCK5A\|p23\|p25\|p35\|p35nck5a
Description	cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Reference	MIM:603460\|HGNC:HGNC:1775\|Ensembl:ENSG00000176749\|HPRD:04586\|Vega:OTTHUMG00000132814
Gene type	protein-coding
Map location	17q11.2
Pascal p-value	9.503E-5
Sherlock p-value	0.92
Fetal beta	0.709
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 14

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg07658718	17	30814514	CDK5R1		-0.021	0.84	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs7132043	chr12	80968399	CDK5R1	8851		0.19		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
LTV1	0.84	0.83
MED4	0.84	0.81
PARP2	0.84	0.80
RAD17	0.83	0.81
EXOC1	0.83	0.81
USP16	0.82	0.81
UBA5	0.82	0.80
GTF2H1	0.82	0.79
HERC4	0.82	0.79
DNAJC10	0.82	0.80

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.75	-0.63
AF347015.2	-0.73	-0.62
AF347015.21	-0.73	-0.59
AF347015.31	-0.73	-0.63
AF347015.8	-0.73	-0.62
MT-CYB	-0.72	-0.60
AF347015.15	-0.70	-0.61
AF347015.33	-0.69	-0.57
AF347015.27	-0.68	-0.58
HIGD1B	-0.68	-0.61

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005509	calcium ion binding	ISS		-
GO:0005515	protein binding	IPI		10721722 \|12223541
GO:0005515	protein binding	ISS		-
GO:0004672	protein kinase activity	TAS		7592934
GO:0016534	cyclin-dependent protein kinase 5 activator activity	IEA		-
GO:0045296	cadherin binding	ISS		-
GO:0043539	protein serine/threonine kinase activator activity	ISS		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007420	brain development	ISS	Brain (GO term level: 7)	-
GO:0007420	brain development	NAS	Brain (GO term level: 7)	10915792
GO:0007413	axonal fasciculation	ISS	neuron, axon (GO term level: 13)	-
GO:0007411	axon guidance	ISS	axon (GO term level: 13)	-
GO:0001764	neuron migration	ISS	neuron (GO term level: 8)	-
GO:0031175	neurite development	ISS	neuron, axon, neurite, dendrite (GO term level: 10)	-
GO:0007158	neuron adhesion	ISS	neuron (GO term level: 5)	-
GO:0045664	regulation of neuron differentiation	NAS	neuron, neurogenesis (GO term level: 9)	10721722
GO:0043525	positive regulation of neuron apoptosis	ISS	neuron (GO term level: 9)	-
GO:0035235	ionotropic glutamate receptor signaling pathway	ISS	glutamate (GO term level: 8)	-
GO:0000079	regulation of cyclin-dependent protein kinase activity	TAS		7592934
GO:0007213	acetylcholine receptor signaling, muscarinic pathway	ISS		-
GO:0008283	cell proliferation	TAS		8090221
GO:0009790	embryonic development	ISS		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043025	cell soma	ISS	axon, dendrite (GO term level: 4)	-
GO:0031594	neuromuscular junction	ISS	neuron, axon, Synap, Neurotransmitter (GO term level: 3)	-
GO:0043197	dendritic spine	ISS	Synap, dendrite (GO term level: 7)	-
GO:0030426	growth cone	ISS	axon, dendrite (GO term level: 5)	-
GO:0030424	axon	ISS	neuron, axon, Neurotransmitter (GO term level: 6)	-
GO:0005634	nucleus	ISS		-
GO:0005737	cytoplasm	ISS		-
GO:0005886	plasma membrane	IEA		-
GO:0016533	cyclin-dependent protein kinase 5 activator complex	IEA		-
GO:0043292	contractile fiber	ISS		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTN1	FLJ40884	actinin, alpha 1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	12223541
AMPH	AMPH1	amphiphysin	Amphiphysin 1 interacts with p35. This interaction was modeled on a demonstrated interaction between human amphiphysin 1 and rat p35.	BIND	11113134
AMPH	AMPH1	amphiphysin	-	HPRD,BioGRID	11113134
CAMK2A	CAMKA \| KIAA0968	calcium/calmodulin-dependent protein kinase II alpha	-	HPRD,BioGRID	12223541
CDK5	PSSALRE	cyclin-dependent kinase 5	p35 interacts with Cdk5. This interaction was modeled on a demonstrated interaction between bovine p35 and human Cdk5.	BIND	9038181
CDK5	PSSALRE	cyclin-dependent kinase 5	-	HPRD,BioGRID	11583627
CDK5	PSSALRE	cyclin-dependent kinase 5	Cdk5 interacts with p35.	BIND	8090221
CDK5R1	CDK5P35 \| CDK5R \| MGC33831 \| NCK5A \| p23 \| p25 \| p35 \| p35nck5a	cyclin-dependent kinase 5, regulatory subunit 1 (p35)	-	HPRD	11389014
CDK5RAP1	C20orf34 \| C42 \| CDK5RAP1.3 \| CDK5RAP1.4 \| CGI-05 \| HSPC167	CDK5 regulatory subunit associated protein 1	-	HPRD,BioGRID	10721722 \|10915792 \|11882646
CDK5RAP1	C20orf34 \| C42 \| CDK5RAP1.3 \| CDK5RAP1.4 \| CGI-05 \| HSPC167	CDK5 regulatory subunit associated protein 1	-	HPRD	11882646
CDK5RAP2	C48 \| Cep215 \| DKFZp686B1070 \| DKFZp686D1070 \| KIAA1633 \| MCPH3	CDK5 regulatory subunit associated protein 2	in vitro in vivo Reconstituted Complex	BioGRID	10915792 \|11882646
CDK5RAP2	C48 \| Cep215 \| DKFZp686B1070 \| DKFZp686D1070 \| KIAA1633 \| MCPH3	CDK5 regulatory subunit associated protein 2	-	HPRD	10721722
CDK5RAP3	C53 \| HSF-27 \| IC53 \| LZAP \| MST016 \| OK/SW-cl.114	CDK5 regulatory subunit associated protein 3	-	HPRD	10721722 \|10915792
CDK5RAP3	C53 \| HSF-27 \| IC53 \| LZAP \| MST016 \| OK/SW-cl.114	CDK5 regulatory subunit associated protein 3	-	HPRD,BioGRID	11882646
CDK9	C-2k \| CDC2L4 \| CTK1 \| PITALRE \| TAK	cyclin-dependent kinase 9	-	HPRD	12037672
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	Affinity Capture-Western Reconstituted Complex	BioGRID	11168528
LMTK2	AATYK2 \| BREK \| KIAA1079 \| KPI-2 \| KPI2 \| LMR2 \| cprk	lemur tyrosine kinase 2	-	HPRD	12832520
NES	FLJ21841 \| Nbla00170	nestin	-	HPRD	12832492
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	-	HPRD	11604394
PCTK1	FLJ16665 \| PCTAIRE \| PCTAIRE1 \| PCTGAIRE	PCTAIRE protein kinase 1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	12084709
SET	2PP2A \| I2PP2A \| IGAAD \| IPP2A2 \| PHAPII \| TAF-I \| TAF-IBETA	SET nuclear oncogene	-	HPRD,BioGRID	11741927
TSC22D4	THG-1 \| THG1	TSC22 domain family, member 4	Two-hybrid	BioGRID	16189514
TTBK1	BDTK \| KIAA1855 \| RP3-330M21.4	tau tubulin kinase 1	-	HPRD	7556643

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ALZHEIMERS DISEASE	169	110	All SZGR 2.0 genes in this pathway
BIOCARTA P35ALZHEIMERS PATHWAY	11	9	All SZGR 2.0 genes in this pathway
BIOCARTA CDK5 PATHWAY	11	11	All SZGR 2.0 genes in this pathway
BIOCARTA RAC1 PATHWAY	23	16	All SZGR 2.0 genes in this pathway
BIOCARTA CK1 PATHWAY	17	17	All SZGR 2.0 genes in this pathway
PID REELIN PATHWAY	29	29	All SZGR 2.0 genes in this pathway
PID REG GR PATHWAY	82	60	All SZGR 2.0 genes in this pathway
PID LIS1 PATHWAY	28	22	All SZGR 2.0 genes in this pathway
PID MAPK TRK PATHWAY	34	31	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME CRMPS IN SEMA3A SIGNALING	14	14	All SZGR 2.0 genes in this pathway
REACTOME SEMAPHORIN INTERACTIONS	68	53	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP	233	161	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP	276	165	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 2 UP	139	83	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP	341	197	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN	459	276	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR DN	209	122	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN	226	132	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP	552	347	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP	211	136	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
NUNODA RESPONSE TO DASATINIB IMATINIB UP	29	20	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN	164	111	All SZGR 2.0 genes in this pathway
KIM MYCL1 AMPLIFICATION TARGETS UP	13	11	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
STARK HYPPOCAMPUS 22Q11 DELETION UP	53	40	All SZGR 2.0 genes in this pathway
STARK BRAIN 22Q11 DELETION	13	10	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN	357	212	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN	271	175	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2	473	224	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS DN	292	189	All SZGR 2.0 genes in this pathway
OUILLETTE CLL 13Q14 DELETION DN	60	38	All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING UP	115	80	All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1	91	75	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
HOFFMANN IMMATURE TO MATURE B LYMPHOCYTE UP	43	34	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6	456	285	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN	414	237	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP	211	131	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 1HR UP	34	26	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN	114	69	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	2673	2679	m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-103/107	2094	2100	m8	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	2094	2100	m8	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-148/152	2695	2702	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-15/16/195/424/497	2095	2102	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-183	2404	2410	m8	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-208	2211	2217	1A	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-23	1315	1322	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1315	1322	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-27	1481	1487	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1481	1487	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-323	1315	1321	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-362	24	30	m8	hsa-miR-362	AAUCCUUGGAACCUAGGUGUGAGU
miR-376	2100	2106	1A	hsa-miR-376a	AUCAUAGAGGAAAAUCCACGU
miR-376	2100	2106	1A	hsa-miR-376b	AUCAUAGAGGAAAAUCCAUGUU
miR-433-3p	2615	2621	1A	hsa-miR-433^brain	AUCAUGAUGGGCUCCUCGGUGU
miR-499	2211	2217	1A	hsa-miR-499	UUAAGACUUGCAGUGAUGUUUAA
miR-503	2096	2102	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CDK5R1