Summary ?
GeneID8892
SymbolEIF2B2
SynonymsEIF-2Bbeta|EIF2B
Descriptioneukaryotic translation initiation factor 2B subunit beta
ReferenceMIM:606454|HGNC:HGNC:3258|HPRD:05923|
Gene typeprotein-coding
Map location14q24.3
Pascal p-value0.504
Sherlock p-value0.965
Fetal beta-0.176
DMG1 (# studies)
eGeneHypothalamus
Meta

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Montano_2016Genome-wide DNA methylation analysisThis dataset includes 172 replicated associations between CpGs with schizophrenia. 1
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 3 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg159435841475472643EIF2B23.63E-4-0.0060.193DMG:Montano_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
SH3TC10.620.35
IGFBP10.590.27
C10orf100.570.21
EDN10.560.13
IL4R0.560.39
HRCT10.54-0.06
TBX10.510.26
CLDN50.490.20
TNFRSF12A0.480.25
CEBPD0.470.16
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
HSPA5-0.35-0.26
HDHD2-0.35-0.21
SBDS-0.35-0.25
ERGIC2-0.34-0.23
PDHB-0.34-0.22
C19orf2-0.34-0.18
PPP2CB-0.34-0.20
IARS2-0.34-0.19
AC023598.3-0.33-0.31
PPP2R5A-0.33-0.29

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005085guanyl-nucleotide exchange factor activityIDA11323413 
GO:0005085guanyl-nucleotide exchange factor activityIMP15054402 
GO:0003743translation initiation factor activityIDA16289705 
GO:0005515protein bindingIPI15060152 
GO:0005524ATP bindingIDA11323413 
GO:0005525GTP bindingIDA11323413 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007417central nervous system developmentIMPBrain (GO term level: 6)15776425 
GO:0014003oligodendrocyte developmentIMPaxon, oligodendrocyte, Glial (GO term level: 10)15217090 
GO:0042552myelinationIMPneuron, axon, Brain, oligodendrocyte (GO term level: 13)14566705 
GO:0001541ovarian follicle developmentIMP15507143 
GO:0006446regulation of translational initiationTAS15060152 
GO:0009408response to heatISS-
GO:0009408response to heatTAS12499492 
GO:0009749response to glucose stimulusISS-
GO:0043434response to peptide hormone stimulusISS-
GO:0044237cellular metabolic processIEA-
GO:0051716cellular response to stimulusIDA8626696 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005851eukaryotic translation initiation factor 2B complexIDA11323413 |15060152 
GO:0005634nucleusIDA18029348 
GO:0005730nucleolusIDA18029348 
GO:0005737cytoplasmIDA11323413 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
BIOCARTA VEGF PATHWAY 2918All SZGR 2.0 genes in this pathway
REACTOME TRANSLATION 22275All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF PROTEINS 518242All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP 293179All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142669All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP 536340All SZGR 2.0 genes in this pathway
HEIDENBLAD AMPLICON 12P11 12 UP 3317All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN 245154All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN 162102All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS DN 14192All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP 973570All SZGR 2.0 genes in this pathway
GU PDEF TARGETS DN 3920All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3782672741A,m8hsa-miR-378CUCCUGACUCCAGGUCCUGUGU