Gene Page: CCND3
Summary ?
GeneID | 896 |
Symbol | CCND3 |
Synonyms | - |
Description | cyclin D3 |
Reference | MIM:123834|HGNC:HGNC:1585|Ensembl:ENSG00000112576|HPRD:00452|Vega:OTTHUMG00000014690 |
Gene type | protein-coding |
Map location | 6p21 |
Pascal p-value | 0.073 |
Sherlock p-value | 0.998 |
Fetal beta | -1.124 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.3258 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04111789 | 6 | 41908262 | CCND3 | 4.008E-4 | 0.571 | 0.044 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
POLR1B | 0.94 | 0.93 |
ADNP | 0.94 | 0.92 |
RBM12 | 0.93 | 0.94 |
EPC2 | 0.93 | 0.93 |
ZNF564 | 0.93 | 0.91 |
RSPRY1 | 0.93 | 0.93 |
ZNF709 | 0.93 | 0.89 |
TCEB3 | 0.93 | 0.90 |
NCOA5 | 0.93 | 0.91 |
ZNF518B | 0.93 | 0.91 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AIFM3 | -0.76 | -0.81 |
MT-CO2 | -0.74 | -0.86 |
S100B | -0.73 | -0.83 |
HLA-F | -0.73 | -0.76 |
HSD17B14 | -0.73 | -0.82 |
FXYD1 | -0.73 | -0.86 |
AF347015.31 | -0.73 | -0.84 |
AF347015.27 | -0.72 | -0.82 |
AF347015.33 | -0.72 | -0.83 |
MT-CYB | -0.71 | -0.84 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004693 | cyclin-dependent protein kinase activity | IEA | neuron (GO term level: 8) | - |
GO:0005515 | protein binding | IEA | - | |
GO:0005515 | protein binding | IPI | 11896535 |15232106 |17274640 |17517622 | |
GO:0019901 | protein kinase binding | IPI | 8114739 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001934 | positive regulation of protein amino acid phosphorylation | IDA | 8114739 | |
GO:0007165 | signal transduction | IEA | - | |
GO:0007049 | cell cycle | IEA | - | |
GO:0042098 | T cell proliferation | IEA | - | |
GO:0051301 | cell division | IEA | - | |
GO:0045737 | positive regulation of cyclin-dependent protein kinase activity | IDA | 8114739 | |
GO:0051726 | regulation of cell cycle | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000307 | cyclin-dependent protein kinase holoenzyme complex | IDA | 8114739 | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AKAP8 | AKAP95 | DKFZp586B1222 | A kinase (PRKA) anchor protein 8 | - | HPRD,BioGRID | 14641107 |
AREG | AR | CRDGF | MGC13647 | SDGF | amphiregulin | - | HPRD | 11469683 |
ATP5C1 | ATP5C | ATP5CL1 | ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 | Two-hybrid | BioGRID | 16169070 |
CASP2 | CASP-2 | ICH-1L | ICH-1L/1S | ICH1 | NEDD2 | caspase 2, apoptosis-related cysteine peptidase | - | HPRD,BioGRID | 12011445 |
CDC2L1 | CDC2L2 | CDK11 | CDK11-p110 | CDK11-p46 | CDK11-p58 | CLK-1 | FLJ59152 | PK58 | p58 | p58CDC2L1 | p58CLK-1 | cell division cycle 2-like 1 (PITSLRE proteins) | - | HPRD,BioGRID | 12082095 |
CDK4 | CMM3 | MGC14458 | PSK-J3 | cyclin-dependent kinase 4 | - | HPRD,BioGRID | 10342870 |
CDK6 | MGC59692 | PLSTIRE | STQTL11 | cyclin-dependent kinase 6 | - | HPRD,BioGRID | 8114739 |11360184 |
CDKN1A | CAP20 | CDKN1 | CIP1 | MDA-6 | P21 | SDI1 | WAF1 | p21CIP1 | cyclin-dependent kinase inhibitor 1A (p21, Cip1) | Two-hybrid | BioGRID | 16189514 |
CDKN1B | CDKN4 | KIP1 | MEN1B | MEN4 | P27KIP1 | cyclin-dependent kinase inhibitor 1B (p27, Kip1) | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 10342870 |11360184 |16189514 |
CRABP2 | CRABP-II | RBP6 | cellular retinoic acid binding protein 2 | in vitro in vivo Two-hybrid | BioGRID | 12482873 |
DMTF1 | DMP1 | DMTF | FLJ41265 | hDMP1 | cyclin D binding myb-like transcription factor 1 | - | HPRD | 8887674 |
DTNBP1 | DBND | DKFZp564K192 | FLJ30031 | HPS7 | MGC20210 | My031 | SDY | dystrobrevin binding protein 1 | Two-hybrid | BioGRID | 16189514 |
EFEMP2 | FBLN4 | MBP1 | UPH1 | EGF-containing fibulin-like extracellular matrix protein 2 | Two-hybrid | BioGRID | 16189514 |
EIF3K | ARG134 | EIF3-p28 | EIF3S12 | HSPC029 | M9 | MSTP001 | PLAC-24 | PLAC24 | PRO1474 | PTD001 | eukaryotic translation initiation factor 3, subunit K | - | HPRD,BioGRID | 15327989 |
MAF1 | MGC20332 | MGC31779 | MGC39758 | MAF1 homolog (S. cerevisiae) | Two-hybrid | BioGRID | 16189514 |
MCM10 | CNA43 | DNA43 | MGC126776 | PRO2249 | minichromosome maintenance complex component 10 | Affinity Capture-Western | BioGRID | 16189514 |
MCM10 | CNA43 | DNA43 | MGC126776 | PRO2249 | minichromosome maintenance complex component 10 | - | HPRD | 15232106 |
NPDC1 | CAB | CAB- | CAB-1 | CAB1 | DKFZp586J0523 | neural proliferation, differentiation and control, 1 | - | HPRD,BioGRID | 11042687 |
PCNA | MGC8367 | proliferating cell nuclear antigen | - | HPRD,BioGRID | 7908906 |
RARA | NR1B1 | RAR | retinoic acid receptor, alpha | in vitro in vivo Two-hybrid | BioGRID | 12482873 |
RB1 | OSRC | RB | p105-Rb | pRb | pp110 | retinoblastoma 1 | Two-hybrid | BioGRID | 17972097 |
RBX1 | BA554C12.1 | MGC13357 | MGC1481 | RNF75 | ROC1 | ring-box 1 | Affinity Capture-Western | BioGRID | 11311237 |
TSC2 | FLJ43106 | LAM | TSC4 | tuberous sclerosis 2 | Affinity Capture-Western | BioGRID | 16357142 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CELL CYCLE | 128 | 84 | All SZGR 2.0 genes in this pathway |
KEGG P53 SIGNALING PATHWAY | 69 | 45 | All SZGR 2.0 genes in this pathway |
KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
KEGG JAK STAT SIGNALING PATHWAY | 155 | 105 | All SZGR 2.0 genes in this pathway |
BIOCARTA CELLCYCLE PATHWAY | 23 | 15 | All SZGR 2.0 genes in this pathway |
WNT SIGNALING | 89 | 71 | All SZGR 2.0 genes in this pathway |
PID E2F PATHWAY | 74 | 48 | All SZGR 2.0 genes in this pathway |
PID AR PATHWAY | 61 | 46 | All SZGR 2.0 genes in this pathway |
PID IL2 STAT5 PATHWAY | 30 | 23 | All SZGR 2.0 genes in this pathway |
PID RB 1PATHWAY | 65 | 46 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE | 421 | 253 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CYCLE MITOTIC | 325 | 185 | All SZGR 2.0 genes in this pathway |
REACTOME G1 PHASE | 38 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME MITOTIC G1 G1 S PHASES | 137 | 79 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSCRIPTIONAL REGULATION OF WHITE ADIPOCYTE DIFFERENTIATION | 72 | 53 | All SZGR 2.0 genes in this pathway |
LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS UP | 290 | 177 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN | 187 | 115 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA BY DMOG DN | 59 | 40 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A TARGETS UP | 67 | 40 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A AND HIF2A TARGETS UP | 41 | 22 | All SZGR 2.0 genes in this pathway |
NUNODA RESPONSE TO DASATINIB IMATINIB UP | 29 | 20 | All SZGR 2.0 genes in this pathway |
BAKER HEMATOPOIESIS STAT3 TARGETS | 16 | 12 | All SZGR 2.0 genes in this pathway |
BAKER HEMATOPOESIS STAT5 TARGETS | 7 | 7 | All SZGR 2.0 genes in this pathway |
MYLLYKANGAS AMPLIFICATION HOT SPOT 15 | 13 | 9 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
GUENTHER GROWTH SPHERICAL VS ADHERENT DN | 26 | 19 | All SZGR 2.0 genes in this pathway |
HE PTEN TARGETS UP | 16 | 15 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
SHIN B CELL LYMPHOMA CLUSTER 3 | 28 | 23 | All SZGR 2.0 genes in this pathway |
MORI IMMATURE B LYMPHOCYTE DN | 90 | 55 | All SZGR 2.0 genes in this pathway |
MORI MATURE B LYMPHOCYTE DN | 75 | 43 | All SZGR 2.0 genes in this pathway |
ROSS ACUTE MYELOID LEUKEMIA CBF | 82 | 57 | All SZGR 2.0 genes in this pathway |
GOLUB ALL VS AML UP | 24 | 20 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS B LYMPHOCYTE DN | 38 | 25 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK UP | 87 | 58 | All SZGR 2.0 genes in this pathway |
POMEROY MEDULLOBLASTOMA DESMOPLASIC VS CLASSIC DN | 59 | 35 | All SZGR 2.0 genes in this pathway |
TENEDINI MEGAKARYOCYTE MARKERS | 66 | 48 | All SZGR 2.0 genes in this pathway |
CROMER METASTASIS UP | 79 | 46 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS MATURE CELL | 293 | 160 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DELASERNA MYOD TARGETS UP | 89 | 51 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 2 | 72 | 52 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
GHO ATF5 TARGETS DN | 16 | 10 | All SZGR 2.0 genes in this pathway |
HILLION HMGA1B TARGETS | 92 | 68 | All SZGR 2.0 genes in this pathway |
LEIN CHOROID PLEXUS MARKERS | 103 | 61 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARZEC IL2 SIGNALING UP | 115 | 80 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
AMBROSINI FLAVOPIRIDOL TREATMENT TP53 | 109 | 63 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D CLUSTER DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
LEE DIFFERENTIATING T LYMPHOCYTE | 200 | 115 | All SZGR 2.0 genes in this pathway |
WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
KOBAYASHI EGFR SIGNALING 24HR DN | 251 | 151 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA3 DN | 69 | 38 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL IL3RA | 9 | 6 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE DN | 103 | 67 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
ZHU SKIL TARGETS DN | 9 | 5 | All SZGR 2.0 genes in this pathway |
DORMOY ELAVL1 TARGETS | 17 | 10 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
BOUDOUKHA BOUND BY IGF2BP2 | 111 | 59 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-130/301 | 157 | 163 | 1A | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-330 | 571 | 577 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.