Gene Page: KALRN
Summary ?
GeneID | 8997 |
Symbol | KALRN |
Synonyms | ARHGEF24|CHD5|CHDS5|DUET|DUO|HAPIP|TRAD |
Description | kalirin, RhoGEF kinase |
Reference | MIM:604605|HGNC:HGNC:4814|Ensembl:ENSG00000160145|HPRD:06859|HPRD:12169|Vega:OTTHUMG00000125545 |
Gene type | protein-coding |
Map location | 3q21.2 |
Pascal p-value | 1.363E-4 |
Sherlock p-value | 0.662 |
Fetal beta | -3.473 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | G2Cdb.human_PocklingtonH1 G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg13151664 | 3 | 123813232 | KALRN | 1.494E-4 | 0.434 | 0.032 | DMG:Wockner_2014 |
cg21618455 | 3 | 123950018 | KALRN | 4.327E-4 | 0.434 | 0.045 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6786220 | chr3 | 124868890 | KALRN | 8997 | 0.16 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PFKFB2 | 0.78 | 0.76 |
RCAN2 | 0.76 | 0.66 |
AGPAT9 | 0.76 | 0.65 |
SCN1A | 0.76 | 0.72 |
RAB11FIP5 | 0.76 | 0.74 |
SLC24A2 | 0.75 | 0.74 |
ERMP1 | 0.74 | 0.74 |
SCN2B | 0.74 | 0.66 |
SLC7A8 | 0.74 | 0.70 |
OGDHL | 0.73 | 0.61 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
BCL7C | -0.44 | -0.55 |
WDR86 | -0.41 | -0.41 |
RAMP2 | -0.39 | -0.47 |
EMID1 | -0.39 | -0.40 |
AC006276.2 | -0.38 | -0.46 |
RP9P | -0.38 | -0.56 |
CCDC28B | -0.36 | -0.41 |
TBC1D10A | -0.36 | -0.32 |
SNHG12 | -0.36 | -0.46 |
GTF3C6 | -0.36 | -0.38 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005089 | Rho guanyl-nucleotide exchange factor activity | IEA | - | |
GO:0005085 | guanyl-nucleotide exchange factor activity | TAS | 9285789 | |
GO:0000287 | magnesium ion binding | IEA | - | |
GO:0005515 | protein binding | ISS | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004674 | protein serine/threonine kinase activity | TAS | 10023074 | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | ISS | neurite (GO term level: 5) | - |
GO:0006468 | protein amino acid phosphorylation | TAS | 10023074 | |
GO:0007242 | intracellular signaling cascade | ISS | - | |
GO:0016192 | vesicle-mediated transport | TAS | 9285789 | |
GO:0035023 | regulation of Rho protein signal transduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0015629 | actin cytoskeleton | TAS | 10023074 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID EPHB FWD PATHWAY | 40 | 38 | All SZGR 2.0 genes in this pathway |
PID ARF6 DOWNSTREAM PATHWAY | 15 | 14 | All SZGR 2.0 genes in this pathway |
PID RAC1 REG PATHWAY | 38 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK | 205 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME NRAGE SIGNALS DEATH THROUGH JNK | 43 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE | 60 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA Q SIGNALLING EVENTS | 184 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA1213 SIGNALLING EVENTS | 74 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
HORIUCHI WTAP TARGETS UP | 306 | 188 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP | 211 | 136 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
ZHOU TNF SIGNALING 4HR | 54 | 36 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS UP | 175 | 116 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
ZHOU TNF SIGNALING 30MIN | 54 | 36 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 30MIN DN | 150 | 99 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP | 259 | 159 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-135 | 1121 | 1127 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA | ||||
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-139 | 994 | 1000 | 1A | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
miR-218 | 607 | 614 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-22 | 795 | 801 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-377 | 38 | 44 | 1A | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-381 | 650 | 657 | 1A,m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-9 | 44 | 50 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.