Gene Page: CLDN12
Summary ?
GeneID | 9069 |
Symbol | CLDN12 |
Synonyms | - |
Description | claudin 12 |
Reference | MIM:611232|HGNC:HGNC:2034|Ensembl:ENSG00000157224|HPRD:13064|Vega:OTTHUMG00000156612 |
Gene type | protein-coding |
Map location | 7q21 |
Pascal p-value | 0.645 |
Sherlock p-value | 0.466 |
Fetal beta | -0.121 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg02399449 | 7 | 90032850 | CLDN12 | -0.026 | 0.25 | DMG:Nishioka_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs9288868 | chr3 | 108077969 | CLDN12 | 9069 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005198 | structural molecule activity | IEA | - | |
GO:0042802 | identical protein binding | ISS | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016338 | calcium-independent cell-cell adhesion | ISS | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005923 | tight junction | ISS | Brain (GO term level: 10) | - |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME CELL CELL COMMUNICATION | 120 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CELL JUNCTION ORGANIZATION | 56 | 31 | All SZGR 2.0 genes in this pathway |
REACTOME TIGHT JUNCTION INTERACTIONS | 29 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME CELL JUNCTION ORGANIZATION | 78 | 43 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 7Q21 Q22 AMPLICON | 76 | 33 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS UP | 170 | 107 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
WINZEN DEGRADED VIA KHSRP | 100 | 70 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 550 | 557 | 1A,m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-15/16/195/424/497 | 143 | 150 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-23 | 177 | 184 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 177 | 183 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-381 | 1738 | 1744 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-485-5p | 37 | 43 | 1A | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
miR-503 | 144 | 150 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.