SZGR2

Summary ?

GeneID	90809
Symbol	TMEM55B
Synonyms	C14orf9
Description	transmembrane protein 55B
Reference	MIM:609865\|HGNC:HGNC:19299\|Ensembl:ENSG00000165782\|HPRD:12660\|Vega:OTTHUMG00000029545
Gene type	protein-coding
Map location	14q11.2
Pascal p-value	0.718
Sherlock p-value	0.775
Fetal beta	-0.636
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DNM:Guipponi_2014	Whole Exome Sequencing analysis	49 DNMs were identified by comparing the exome of 53 individuals with sporadic SCZ and of their non-affected parents
GSMA_I	Genome scan meta-analysis	Psr: 0.047

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
TMEM55B			G	A	NM_001100814	p.V100V	synonymous	NA	NA	Schizophrenia	DNM:Guipponi_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs921442	chr11	57920868	TMEM55B	90809		0.14		trans
rs9571716	chr13	67711344	TMEM55B	90809		0.14		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016787	hydrolase activity	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005765	lysosomal membrane	IEA		-
GO:0005768	endosome	IEA		-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0031902	late endosome membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
JAERVINEN AMPLIFIED IN LARYNGEAL CANCER	40	24	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN	517	309	All SZGR 2.0 genes in this pathway
CHIBA RESPONSE TO TSA	50	31	All SZGR 2.0 genes in this pathway
GRADE COLON VS RECTAL CANCER DN	56	36	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
LINSLEY MIR16 TARGETS	206	127	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	327	334	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-142-3p	50	56	m8	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TMEM55B