Summary ?
GeneID91522
SymbolCOL23A1
Synonyms-
Descriptioncollagen type XXIII alpha 1
ReferenceMIM:610043|HGNC:HGNC:22990|Ensembl:ENSG00000050767|HPRD:16733|Vega:OTTHUMG00000130890
Gene typeprotein-coding
Map location5q35.3
Pascal p-value0.381
Sherlock p-value0.759
Fetal beta-0.503
DMG1 (# studies)
eGeneCerebellar Hemisphere
Cerebellum
Myers' cis & trans
Meta

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.0276 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.1204 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg045910345178017937COL23A15.93E-83.2510.003DMG:Wockner_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs752662chr643637062COL23A1915220.11trans
rs2236345chr643648802COL23A1915220.2trans
rs1334600chr643649520COL23A1915220.14trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI15231747 
GO:0005198structural molecule activityIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME EXTRACELLULAR MATRIX ORGANIZATION 8742All SZGR 2.0 genes in this pathway
REACTOME COLLAGEN FORMATION 5831All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514330All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP 11679All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469239All SZGR 2.0 genes in this pathway
MCCABE HOXC6 TARGETS DN 2115All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491319All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME2 1711All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN 308187All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489314All SZGR 2.0 genes in this pathway
NABA COLLAGENS 4426All SZGR 2.0 genes in this pathway
NABA CORE MATRISOME 275148All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028559All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-140106310701A,m8hsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-299-5p106210681Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
miR-93.hd/291-3p/294/295/302/372/373/520517523m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU