Gene Page: NEXN
Summary ?
GeneID | 91624 |
Symbol | NEXN |
Synonyms | CMH20|NELIN |
Description | nexilin (F actin binding protein) |
Reference | MIM:613121|HGNC:HGNC:29557|Ensembl:ENSG00000162614|HPRD:11388|Vega:OTTHUMG00000040533 |
Gene type | protein-coding |
Map location | 1p31.1 |
Pascal p-value | 0.033 |
eGene | Cortex Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02692 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10994209 | chr10 | 61877705 | NEXN | 91624 | 0.03 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0051015 | actin filament binding | IPI | 15823560 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030334 | regulation of cell migration | IDA | 15823560 | |
GO:0051493 | regulation of cytoskeleton organization | IEP | 15823560 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005924 | cell-substrate adherens junction | ISS | - | |
GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP | 205 | 140 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
HOOI ST7 TARGETS UP | 94 | 57 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP | 194 | 122 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS DN | 232 | 139 | All SZGR 2.0 genes in this pathway |
SENESE HDAC2 TARGETS DN | 133 | 77 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LPS UP | 431 | 237 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL DN | 226 | 132 | All SZGR 2.0 genes in this pathway |
CHEBOTAEV GR TARGETS DN | 120 | 73 | All SZGR 2.0 genes in this pathway |
YANAGIHARA ESX1 TARGETS | 30 | 19 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
RICKMAN HEAD AND NECK CANCER F | 54 | 32 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
FONTAINE FOLLICULAR THYROID ADENOMA UP | 75 | 43 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-325 | 78 | 84 | m8 | hsa-miR-325 | CCUAGUAGGUGUCCAGUAAGUGU |
miR-328 | 156 | 162 | 1A | hsa-miR-328brain | CUGGCCCUCUCUGCCCUUCCGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.