SZGR2

Summary ?

GeneID	919
Symbol	CD247
Synonyms	CD3-ZETA\|CD3H\|CD3Q\|CD3Z\|IMD25\|T3Z\|TCRZ
Description	CD247 molecule
Reference	MIM:186780\|HGNC:HGNC:1677\|Ensembl:ENSG00000198821\|HPRD:01729\|Vega:OTTHUMG00000034593
Gene type	protein-coding
Map location	1q24.2
Sherlock p-value	0.696
Fetal beta	-0.317
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:vanEijk_2014	Genome-wide DNA methylation analysis	This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250).	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg09554443	1	167487762	CD247	0.004	-4.422		DMG:vanEijk_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs13375406	chr1	95606304	CD247	919	0.13	trans
rs16838771	chr1	157511227	CD247	919	7.906E-5	trans
rs16856639	chr1	166116296	CD247	919	0.15	trans
rs973381	chr1	166121317	CD247	919	0.15	trans
rs1538755	chr1	210893874	CD247	919	0.13	trans
rs825935	chr2	4808721	CD247	919	0.19	trans
rs825932	chr2	4811625	CD247	919	0.07	trans
rs16865228	chr2	6629622	CD247	919	0.1	trans
rs16865230	chr2	6630187	CD247	919	0.1	trans
rs11691188	chr2	6631799	CD247	919	0.1	trans
rs3755119	chr2	53957339	CD247	919	0.05	trans
rs17045286	chr2	54049393	CD247	919	3.687E-4	trans
rs10202944	chr2	72257857	CD247	919	0.15	trans
rs7602648	chr2	104661176	CD247	919	0.03	trans
rs6708612	chr2	148165722	CD247	919	0.17	trans
rs6729020	chr2	189064719	CD247	919	0.13	trans
snp_a-2186147		0	CD247	919	0.02	trans
rs6803351	chr3	17336986	CD247	919	0	trans
rs11916205	chr3	17392363	CD247	919	0	trans
rs17043486	chr3	17399005	CD247	919	0	trans
rs17029249	chr3	17416384	CD247	919	0	trans
rs10510474	chr3	17417495	CD247	919	0	trans
rs17043623	chr3	17478890	CD247	919	0	trans
rs11128830	chr3	17481727	CD247	919	0	trans
rs4378948		0	CD247	919	0.12	trans
rs11927611	chr3	17848434	CD247	919	0	trans
rs6793958	chr3	17853055	CD247	919	2.217E-10	trans
rs17044072	chr3	17854496	CD247	919	0.01	trans
rs17044097	chr3	17889750	CD247	919	0	trans
rs17044102	chr3	17889838	CD247	919	0.03	trans
rs4591529	chr3	32330610	CD247	919	0.15	trans
rs7626782		0	CD247	919	0.03	trans
rs2600956	chr3	132624112	CD247	919	0.12	trans
rs1452144	chr3	132627627	CD247	919	0.12	trans
rs7635430	chr3	180152035	CD247	919	0.11	trans
rs1291259		0	CD247	919	0	trans
rs17005625	chr4	141141923	CD247	919	0.09	trans
rs17005641	chr4	141152656	CD247	919	0.04	trans
rs10026641	chr4	183431866	CD247	919	0	trans
rs11723043	chr4	189507117	CD247	919	0.04	trans
rs4702089	chr5	15640330	CD247	919	0.08	trans
rs4702104	chr5	15746397	CD247	919	0.01	trans
rs17138463	chr5	115286058	CD247	919	0.07	trans
rs17138468	chr5	115288423	CD247	919	0.05	trans
rs10519531	chr5	117332352	CD247	919	2.702E-10	trans
rs6867333	chr5	117339065	CD247	919	0.05	trans
rs17736846	chr5	169133824	CD247	919	0.02	trans
rs9503329	chr6	2894607	CD247	919	0	trans
rs17458000	chr6	151384414	CD247	919	0	trans
rs1321606	chr6	153545278	CD247	919	0.17	trans
rs163007	chr6	155726495	CD247	919	0.15	trans
rs7760005	chr6	156850663	CD247	919	0.02	trans
rs11983989	chr7	46351006	CD247	919	0.09	trans
rs17172680	chr7	46362331	CD247	919	0.09	trans
rs17172688	chr7	46396563	CD247	919	0.09	trans
rs11978272	chr7	80119689	CD247	919	0.2	trans
rs17163613	chr7	90764256	CD247	919	6.475E-5	trans
rs17684427	chr7	122482976	CD247	919	0.15	trans
rs7796458	chr7	154873701	CD247	919	0.13	trans
rs1474448	chr8	16353122	CD247	919	0.09	trans
rs4737205	chr8	65995897	CD247	919	0.19	trans
rs17495371		0	CD247	919	0	trans
rs17495754	chr8	82152549	CD247	919	0.08	trans
rs7813477	chr8	85144311	CD247	919	0.06	trans
rs4878586	chr9	27810413	CD247	919	0.05	trans
rs1410577	chr9	90283060	CD247	919	0.18	trans
rs4742740	chr9	101524552	CD247	919	0.07	trans
rs4743277	chr9	101557528	CD247	919	0.06	trans
rs11252838	chr10	4972173	CD247	919	0.01	trans
rs16933426	chr10	78113005	CD247	919	2.036E-5	trans
rs16933436	chr10	78118247	CD247	919	0.18	trans
rs16933437	chr10	78118689	CD247	919	0.18	trans
rs16933467	chr10	78141332	CD247	919	0.18	trans
rs10885916	chr10	118118819	CD247	919	0.04	trans
rs11199540	chr10	122530843	CD247	919	0.02	trans
rs2459087	chr10	123821264	CD247	919	0.01	trans
rs11016704	chr10	128989145	CD247	919	0.17	trans
rs6486418		0	CD247	919	3.568E-4	trans
rs12292520	chr11	48086150	CD247	919	0.05	trans
rs17789481	chr11	48110042	CD247	919	0.2	trans
rs11220020	chr11	125183479	CD247	919	0.09	trans
rs10878919	chr12	69521979	CD247	919	5.246E-4	trans
rs7136572	chr12	95959787	CD247	919	6.866E-9	trans
rs935031	chr12	96861369	CD247	919	0.12	trans
rs10848152	chr12	131062467	CD247	919	0	trans
rs11061005	chr12	131063527	CD247	919	0	trans
rs7989474	chr13	29113187	CD247	919	0.16	trans
rs1335797	chr13	64425435	CD247	919	1.019E-5	trans
rs17115591	chr14	45262026	CD247	919	0.13	trans
rs12588364	chr14	79411335	CD247	919	0.12	trans
rs11159388	chr14	79417713	CD247	919	0.12	trans
rs11159390	chr14	79424474	CD247	919	0.12	trans
rs10147554	chr14	89902966	CD247	919	0.13	trans
rs11623367	chr14	89924832	CD247	919	0	trans
rs8026736	chr15	45364871	CD247	919	0.14	trans
rs10518880	chr15	70491974	CD247	919	0.02	trans
rs7180781	chr15	78455354	CD247	919	0.13	trans
rs17135416	chr16	1645744	CD247	919	0.17	trans
rs4780835	chr16	19985287	CD247	919	0.12	trans
rs7198149	chr16	57920460	CD247	919	0.03	trans
rs7197514	chr16	65652629	CD247	919	0.01	trans
rs16944062	chr16	76272616	CD247	919	0.01	trans
rs16942128	chr17	45764234	CD247	919	0.15	trans
rs12968895	chr18	19650706	CD247	919	0.13	trans
rs9304469	chr18	22169423	CD247	919	0.06	trans
rs17187821	chr18	22209158	CD247	919	0.05	trans
rs17785402	chr20	5173471	CD247	919	0.06	trans
rs2830443	chr21	28109967	CD247	919	0.16	trans
rs6586271	chr21	44362641	CD247	919	0.03	trans
rs12627758	chr22	29382830	CD247	919	0.03	trans
rs16989337	chr22	32025054	CD247	919	0.13	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SECTM1	0.64	0.27
C19orf35	0.63	0.43
KISS1R	0.62	0.21
PTGER1	0.57	0.42
SMOC2	0.56	0.54
AC011500.2	0.54	0.31
C1orf133	0.54	0.39
P2RY1	0.54	0.27
RXRG	0.52	0.33
FAM40B	0.51	0.36

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C18orf8	-0.44	-0.58
GTDC1	-0.43	-0.47
GARNL3	-0.42	-0.52
CABYR	-0.41	-0.58
ZNF30	-0.40	-0.56
CBARA1	-0.40	-0.53
SFXN3	-0.40	-0.51
DYNC1I1	-0.39	-0.48
RNF8	-0.39	-0.51
RAD51C	-0.39	-0.42

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004888	transmembrane receptor activity	IEA		-
GO:0005515	protein binding	IEA		-
GO:0042803	protein homodimerization activity	NAS		12110186
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007166	cell surface receptor linked signal transduction	IEA		-
GO:0044419	interspecies interaction between organisms	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0042101	T cell receptor complex	IDA	Synap (GO term level: 8)	8176201
GO:0005737	cytoplasm	IDA		11390434
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	EXP		11048639 \|11827988 \|15489916 \|17652306
GO:0005886	plasma membrane	IDA		1390434 \|11390434
GO:0042105	alpha-beta T cell receptor complex	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ATXN2	ATX2 \| FLJ46772 \| SCA2 \| TNRC13	ataxin 2	Affinity Capture-Western	BioGRID	9575182
CD2	SRBC \| T11	CD2 molecule	-	HPRD	8977276
CD247	CD3-ZETA \| CD3H \| CD3Q \| CD3Z \| T3Z \| TCRZ	CD247 molecule	-	HPRD	2845582
CD28	MGC138290 \| Tp44	CD28 molecule	-	HPRD	8760790
CD3D	CD3-DELTA \| T3D	CD3d molecule, delta (CD3-TCR complex)	-	HPRD	9485181
CD3E	FLJ18683 \| T3E \| TCRE	CD3e molecule, epsilon (CD3-TCR complex)	-	HPRD	9485181
CD5	LEU1 \| T1	CD5 molecule	-	HPRD	1385158
CSK	MGC117393	c-src tyrosine kinase	-	HPRD	9172452
DOCK2	FLJ46592 \| KIAA0209	dedicator of cytokinesis 2	-	HPRD,BioGRID	12176041
GAB2	KIAA0571	GRB2-associated binding protein 2	-	HPRD,BioGRID	11572860
JAK3	JAK-3 \| JAK3_HUMAN \| JAKL \| L-JAK \| LJAK	Janus kinase 3 (a protein tyrosine kinase, leukocyte)	-	HPRD,BioGRID	11349123
LY6E	RIG-E \| RIGE \| SCA-2 \| SCA2 \| TSA-1	lymphocyte antigen 6 complex, locus E	-	HPRD	9575182
NCR1	CD335 \| LY94 \| NK-p46 \| NKP46	natural cytotoxicity triggering receptor 1	-	HPRD,BioGRID	9625766
NCR3	1C7 \| CD337 \| LY117 \| MALS \| NKp30	natural cytotoxicity triggering receptor 3	-	HPRD	12731048
PTPRC	B220 \| CD45 \| CD45R \| GP180 \| LCA \| LY5 \| T200	protein tyrosine phosphatase, receptor type, C	-	HPRD,BioGRID	7526385
SH2B3	CELIAC13 \| LNK	SH2B adaptor protein 3	-	HPRD	10799879
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD	8656061
SLA	SLA1 \| SLAP	Src-like-adaptor	-	HPRD,BioGRID	10449770
SLA2	C20orf156 \| FLJ21992 \| MGC49845 \| SLAP-2 \| SLAP2	Src-like-adaptor 2	-	HPRD,BioGRID	11891219
STAT5A	MGF \| STAT5	signal transducer and activator of transcription 5A	-	HPRD,BioGRID	9880255
STAT5B	STAT5	signal transducer and activator of transcription 5B	-	HPRD,BioGRID	9880255
TFRC	CD71 \| TFR \| TFR1 \| TRFR	transferrin receptor (p90, CD71)	-	HPRD	9448136
TIRAP	FLJ42305 \| Mal \| wyatt	toll-interleukin 1 receptor (TIR) domain containing adaptor protein	-	HPRD	11572860
TRA@	FLJ22602 \| MGC117436 \| MGC22624 \| MGC23964 \| MGC71411 \| TCRA \| TCRD \| TRA	T cell receptor alpha locus	-	HPRD	2138083
TRAT1	HSPC062 \| TCRIM \| TRIM	T cell receptor associated transmembrane adaptor 1	-	HPRD	9687533 \|11390434
TRAT1	HSPC062 \| TCRIM \| TRIM	T cell receptor associated transmembrane adaptor 1	-	HPRD,BioGRID	11390434
UNC119	HRG4	unc-119 homolog (C. elegans)	-	HPRD,BioGRID	14757743
ZAP70	FLJ17670 \| FLJ17679 \| SRK \| STD \| TZK \| ZAP-70	zeta-chain (TCR) associated protein kinase 70kDa	-	HPRD	8366117

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY	137	92	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
BIOCARTA CSK PATHWAY	24	20	All SZGR 2.0 genes in this pathway
BIOCARTA CTL PATHWAY	15	11	All SZGR 2.0 genes in this pathway
BIOCARTA TCAPOPTOSIS PATHWAY	11	8	All SZGR 2.0 genes in this pathway
BIOCARTA IL17 PATHWAY	17	12	All SZGR 2.0 genes in this pathway
BIOCARTA IL12 PATHWAY	23	17	All SZGR 2.0 genes in this pathway
BIOCARTA TCRA PATHWAY	13	10	All SZGR 2.0 genes in this pathway
BIOCARTA NO2IL12 PATHWAY	17	14	All SZGR 2.0 genes in this pathway
BIOCARTA TOB1 PATHWAY	21	14	All SZGR 2.0 genes in this pathway
BIOCARTA STATHMIN PATHWAY	19	17	All SZGR 2.0 genes in this pathway
BIOCARTA TCR PATHWAY	49	37	All SZGR 2.0 genes in this pathway
BIOCARTA TCYTOTOXIC PATHWAY	14	11	All SZGR 2.0 genes in this pathway
BIOCARTA THELPER PATHWAY	14	11	All SZGR 2.0 genes in this pathway
BIOCARTA CTLA4 PATHWAY	21	18	All SZGR 2.0 genes in this pathway
PID TCR PATHWAY	66	51	All SZGR 2.0 genes in this pathway
PID IL12 2PATHWAY	63	54	All SZGR 2.0 genes in this pathway
PID CD8 TCR PATHWAY	53	42	All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY	102	78	All SZGR 2.0 genes in this pathway
PID HIV NEF PATHWAY	35	26	All SZGR 2.0 genes in this pathway
PID CD8 TCR DOWNSTREAM PATHWAY	65	56	All SZGR 2.0 genes in this pathway
PID IL12 STAT4 PATHWAY	33	29	All SZGR 2.0 genes in this pathway
REACTOME IMMUNOREGULATORY INTERACTIONS BETWEEN A LYMPHOID AND A NON LYMPHOID CELL	70	37	All SZGR 2.0 genes in this pathway
REACTOME TCR SIGNALING	54	46	All SZGR 2.0 genes in this pathway
REACTOME DOWNSTREAM TCR SIGNALING	37	32	All SZGR 2.0 genes in this pathway
REACTOME PHOSPHORYLATION OF CD3 AND TCR ZETA CHAINS	16	15	All SZGR 2.0 genes in this pathway
REACTOME TRANSLOCATION OF ZAP 70 TO IMMUNOLOGICAL SYNAPSE	14	14	All SZGR 2.0 genes in this pathway
REACTOME GENERATION OF SECOND MESSENGER MOLECULES	27	25	All SZGR 2.0 genes in this pathway
REACTOME PD1 SIGNALING	18	14	All SZGR 2.0 genes in this pathway
REACTOME COSTIMULATION BY THE CD28 FAMILY	63	48	All SZGR 2.0 genes in this pathway
REACTOME HIV INFECTION	207	122	All SZGR 2.0 genes in this pathway
REACTOME HOST INTERACTIONS OF HIV FACTORS	132	81	All SZGR 2.0 genes in this pathway
REACTOME THE ROLE OF NEF IN HIV1 REPLICATION AND DISEASE PATHOGENESIS	28	19	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ADAPTIVE IMMUNE SYSTEM	539	350	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN	226	132	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
MOREIRA RESPONSE TO TSA DN	18	16	All SZGR 2.0 genes in this pathway
SCHLINGEMANN SKIN CARCINOGENESIS TPA DN	29	15	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC UP	202	115	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER NORMAL LIKE UP	476	285	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE	200	115	All SZGR 2.0 genes in this pathway
FINAK BREAST CANCER SDPP SIGNATURE	26	11	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
SENGUPTA EBNA1 ANTICORRELATED	173	85	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP	194	133	All SZGR 2.0 genes in this pathway
ROESSLER LIVER CANCER METASTASIS UP	107	72	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-214	410	416	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CD247