Gene Page: NOG
Summary ?
GeneID | 9241 |
Symbol | NOG |
Synonyms | SYM1|SYNS1|SYNS1A |
Description | noggin |
Reference | MIM:602991|HGNC:HGNC:7866|Ensembl:ENSG00000183691|HPRD:04291|Vega:OTTHUMG00000151770 |
Gene type | protein-coding |
Map location | 17q22 |
Pascal p-value | 0.143 |
Fetal beta | 0.182 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
CV:PheWAS | Phenome-wide association studies (PheWAS) | 157 SNPs associated with schizophrenia | 0 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
CV:PheWAS
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SLC6A20 | 0.81 | 0.56 |
SLC22A2 | 0.75 | 0.63 |
SLC13A4 | 0.73 | 0.78 |
SLC5A5 | 0.69 | 0.77 |
OGN | 0.66 | 0.69 |
DSP | 0.62 | 0.56 |
SERPIND1 | 0.61 | 0.69 |
GJB2 | 0.60 | 0.60 |
SLC22A6 | 0.59 | 0.69 |
OMD | 0.59 | 0.54 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
LRRC37A | -0.18 | -0.36 |
CHMP4A | -0.17 | -0.30 |
NBR2 | -0.17 | -0.20 |
C11orf51 | -0.14 | -0.23 |
ACP6 | -0.14 | -0.06 |
USF2 | -0.13 | -0.31 |
ZRSR2 | -0.13 | -0.36 |
HES4 | -0.13 | -0.23 |
SLC25A28 | -0.13 | -0.17 |
C14orf80 | -0.13 | -0.15 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0019955 | cytokine binding | IPI | 8752214 | |
GO:0042803 | protein homodimerization activity | IDA | 11562478 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007420 | brain development | IEA | Brain (GO term level: 7) | - |
GO:0048712 | negative regulation of astrocyte differentiation | ISS | astrocyte, Glial (GO term level: 12) | 10780858 |
GO:0001657 | ureteric bud development | IEA | - | |
GO:0001649 | osteoblast differentiation | ISS | 10780858 | |
GO:0001837 | epithelial to mesenchymal transition | ISS | 10780858 | |
GO:0009953 | dorsal/ventral pattern formation | IDA | 7666191 | |
GO:0007605 | sensory perception of sound | IEA | - | |
GO:0007389 | pattern specification process | IEA | - | |
GO:0042060 | wound healing | ISS | 10780858 | |
GO:0035019 | somatic stem cell maintenance | IMP | 17889703 | |
GO:0042733 | embryonic digit morphogenesis | IMP | 10080184 | |
GO:0030514 | negative regulation of BMP signaling pathway | IEA | - | |
GO:0042474 | middle ear morphogenesis | IMP | 10080184 | |
GO:0051216 | cartilage development | IEA | - | |
GO:0045596 | negative regulation of cell differentiation | IEA | - | |
GO:0048570 | notochord morphogenesis | IEA | - | |
GO:0048706 | embryonic skeletal system development | IMP | 10080184 | |
GO:0048646 | anatomical structure formation | IEA | - | |
GO:0060044 | negative regulation of cardiac muscle cell proliferation | ISS | 10780858 | |
GO:0060173 | limb development | IMP | 10080184 | |
GO:0060272 | embryonic skeletal joint morphogenesis | IMP | 16151340 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | EXP | 17029022 | |
GO:0005576 | extracellular region | IEA | - | |
GO:0005615 | extracellular space | TAS | 10080184 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG TGF BETA SIGNALING PATHWAY | 86 | 64 | All SZGR 2.0 genes in this pathway |
BIOCARTA ALK PATHWAY | 37 | 29 | All SZGR 2.0 genes in this pathway |
PID BMP PATHWAY | 42 | 31 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY BMP | 23 | 15 | All SZGR 2.0 genes in this pathway |
HOOI ST7 TARGETS DN | 123 | 78 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D UP | 157 | 91 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS DN | 232 | 139 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
INGRAM SHH TARGETS UP | 127 | 79 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON | 335 | 181 | All SZGR 2.0 genes in this pathway |
SHEPARD CRUSH AND BURN MUTANT UP | 197 | 110 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
WONG IFNA2 RESISTANCE DN | 34 | 20 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE UP | 149 | 85 | All SZGR 2.0 genes in this pathway |
LEE NAIVE T LYMPHOCYTE | 19 | 10 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-148/152 | 172 | 178 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-181 | 192 | 198 | 1A | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-200bc/429 | 247 | 254 | 1A,m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-329 | 204 | 210 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
miR-369-3p | 249 | 256 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 250 | 256 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.