Gene Page: DNER
Summary ?
| GeneID | 92737 |
| Symbol | DNER |
| Synonyms | UNQ26|bet |
| Description | delta/notch like EGF repeat containing |
| Reference | MIM:607299|HGNC:HGNC:24456|Ensembl:ENSG00000187957|HPRD:09531|Vega:OTTHUMG00000153637 |
| Gene type | protein-coding |
| Map location | 2q36.3 |
| Pascal p-value | 0.008 |
| Sherlock p-value | 0.213 |
| Fetal beta | -0.447 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 7 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0030276 | clathrin binding | TAS | Synap (GO term level: 4) | 11950833 |
| GO:0004888 | transmembrane receptor activity | TAS | 11950833 | |
| GO:0005112 | Notch binding | IEA | - | |
| GO:0005509 | calcium ion binding | NAS | 11950833 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007417 | central nervous system development | IEP | Brain (GO term level: 6) | 11950833 |
| GO:0007416 | synaptogenesis | NAS | Synap (GO term level: 6) | 11950833 |
| GO:0001764 | neuron migration | NAS | neuron (GO term level: 8) | 11950833 |
| GO:0010001 | glial cell differentiation | IEA | Glial (GO term level: 8) | - |
| GO:0007220 | Notch receptor processing | IEA | - | |
| GO:0006897 | endocytosis | NAS | 11950833 | |
| GO:0048741 | skeletal muscle fiber development | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0043025 | cell soma | IEA | axon, dendrite (GO term level: 4) | - |
| GO:0030425 | dendrite | IDA | neuron, axon, dendrite (GO term level: 6) | 11950833 |
| GO:0005769 | early endosome | IDA | 11950833 | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005886 | plasma membrane | IDA | 11950833 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID NOTCH PATHWAY | 59 | 49 | All SZGR 2.0 genes in this pathway |
| REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS | 27 | 18 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH1 | 70 | 46 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA DN | 349 | 157 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 DN | 175 | 82 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| TOMIDA METASTASIS UP | 26 | 13 | All SZGR 2.0 genes in this pathway |
| KIM MYC AMPLIFICATION TARGETS DN | 97 | 51 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 12HR UP | 116 | 79 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
| COLIN PILOCYTIC ASTROCYTOMA VS GLIOBLASTOMA UP | 35 | 32 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
| KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
| MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| KATSANOU ELAVL1 TARGETS UP | 169 | 105 | All SZGR 2.0 genes in this pathway |
| KOHOUTEK CCNT1 TARGETS | 50 | 26 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-148/152 | 534 | 540 | m8 | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
| hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
| hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
| miR-320 | 138 | 144 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.