Gene Page: TJAP1
Summary ?
| GeneID | 93643 |
| Symbol | TJAP1 |
| Synonyms | PILT|TJP4 |
| Description | tight junction associated protein 1 |
| Reference | MIM:612658|HGNC:HGNC:17949|Ensembl:ENSG00000137221|HPRD:10269|Vega:OTTHUMG00000014736 |
| Gene type | protein-coding |
| Map location | 6p21.1 |
| Pascal p-value | 4.853E-5 |
| Sherlock p-value | 0.37 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs3095798 | chr10 | 103299266 | TJAP1 | 93643 | 0.12 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 15263016 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005923 | tight junction | IEA | Brain (GO term level: 10) | - |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN | 180 | 101 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-132/212 | 624 | 631 | 1A,m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
| hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
| miR-194 | 626 | 632 | m8 | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.