SZGR2

Summary ?

GeneID	961
Symbol	CD47
Synonyms	IAP\|MER6\|OA3
Description	CD47 molecule
Reference	MIM:601028\|HGNC:HGNC:1682\|Ensembl:ENSG00000196776\|HPRD:03017\|Vega:OTTHUMG00000044216
Gene type	protein-coding
Map location	3q13.1-q13.2
Pascal p-value	0.005
Sherlock p-value	0.093
Fetal beta	-0.871
eGene	Meta
Support	CELL ADHESION AND TRANSSYNAPTIC SIGNALING

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.04359
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.04047
Expression	Meta-analysis of gene expression	P value: 1.418
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
GYG1	0.85	0.84
SDHD	0.84	0.80
ATPAF1	0.82	0.84
CTBS	0.81	0.77
PEX19	0.81	0.79
HIGD1A	0.81	0.84
TMX2	0.80	0.82
HERC6	0.80	0.78
HIBADH	0.79	0.84
ME1	0.79	0.82

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ANO8	-0.55	-0.59
UPF3A	-0.54	-0.63
SH3BP2	-0.54	-0.67
GMIP	-0.53	-0.48
VAV2	-0.53	-0.53
ZNF311	-0.52	-0.55
CHD3	-0.52	-0.51
CCDC123	-0.52	-0.52
KIAA1949	-0.52	-0.52
VASH1	-0.52	-0.56

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		15383453
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007155	cell adhesion	IEA		-
GO:0007229	integrin-mediated signaling pathway	TAS		8294396
GO:0008284	positive regulation of cell proliferation	IDA		15383453
GO:0022409	positive regulation of cell-cell adhesion	IDA		15383453
GO:0050870	positive regulation of T cell activation	IDA		15383453
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005886	plasma membrane	EXP		16691243
GO:0005886	plasma membrane	TAS		10429193
GO:0005887	integral to plasma membrane	TAS		7998989

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BNIP3	NIP3	BCL2/adenovirus E1B 19kDa interacting protein 3	-	HPRD,BioGRID	12690108
EPB42	MGC116735 \| MGC116737 \| PA	erythrocyte membrane protein band 4.2	-	HPRD	12176912
GNAI1	Gi	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	-	HPRD	11306274
ITGAV	CD51 \| DKFZp686A08142 \| MSK8 \| VNRA	integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)	-	HPRD	10545994
ITGB1	CD29 \| FNRB \| GPIIA \| MDF2 \| MSK12 \| VLA-BETA \| VLAB	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	Affinity Capture-Western	BioGRID	10397731
P2RY2	HP2U \| MGC20088 \| MGC40010 \| P2RU1 \| P2U \| P2U1 \| P2UR \| P2Y2 \| P2Y2R	purinergic receptor P2Y, G-protein coupled, 2	-	HPRD,BioGRID	11331301
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	-	HPRD	9169439
RHAG	CD241 \| RH2 \| RH50A \| Rh50 \| Rh50GP \| SLC42A1	Rh-associated glycoprotein	-	HPRD	8563755 \|12393442
SIRPA	BIT \| CD172A \| MFR \| MYD-1 \| P84 \| PTPNS1 \| SHPS-1 \| SHPS1 \| SIRP \| SIRP-ALPHA-1 \| SIRPalpha \| SIRPalpha2	signal-regulatory protein alpha	-	HPRD	9872987
THBS1	THBS \| TSP \| TSP1	thrombospondin 1	-	HPRD	8550562 \|9169439 \|10397731
THBS1	THBS \| TSP \| TSP1	thrombospondin 1	IAP interacts with TS-1. This interaction was modeled on a demonstrated interaction between pig IAP and human TS-1.	BIND	15700281
UBQLN1	DA41 \| DSK2 \| FLJ90054 \| PLIC-1 \| XDRP1	ubiquilin 1	-	HPRD	10549293

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ECM RECEPTOR INTERACTION	84	53	All SZGR 2.0 genes in this pathway
PID INTEGRIN3 PATHWAY	43	25	All SZGR 2.0 genes in this pathway
REACTOME CELL CELL COMMUNICATION	120	77	All SZGR 2.0 genes in this pathway
REACTOME CELL SURFACE INTERACTIONS AT THE VASCULAR WALL	91	65	All SZGR 2.0 genes in this pathway
REACTOME SIGNAL REGULATORY PROTEIN SIRP FAMILY INTERACTIONS	12	10	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP	372	227	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER DN	406	230	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP	276	165	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS UP	135	82	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP	293	179	All SZGR 2.0 genes in this pathway
OUELLET OVARIAN CANCER INVASIVE VS LMP UP	117	85	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN	394	258	All SZGR 2.0 genes in this pathway
HERNANDEZ MITOTIC ARREST BY DOCETAXEL 2 UP	64	45	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
INAMURA LUNG CANCER SCC SUBTYPES UP	14	9	All SZGR 2.0 genes in this pathway
PUJANA XPRSS INT NETWORK	168	103	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS	148	97	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN	411	249	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE DN	121	79	All SZGR 2.0 genes in this pathway
UEDA PERIFERAL CLOCK	169	111	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS DN	87	69	All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION DN	169	112	All SZGR 2.0 genes in this pathway
SASAKI ADULT T CELL LEUKEMIA	176	122	All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN	245	154	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT REJECTED VS OK UP	63	48	All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION UP	87	67	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA UP	64	46	All SZGR 2.0 genes in this pathway
GERY CEBP TARGETS	126	90	All SZGR 2.0 genes in this pathway
ABRAHAM ALPC VS MULTIPLE MYELOMA DN	19	14	All SZGR 2.0 genes in this pathway
IGLESIAS E2F TARGETS UP	151	103	All SZGR 2.0 genes in this pathway
RAMALHO STEMNESS DN	74	55	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
MCCLUNG COCAINE REWARD 5D	79	62	All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS DN	57	42	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND TBH	60	42	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP	487	303	All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS UP	198	132	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 7	51	34	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER T7	98	63	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P3	160	103	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN	220	147	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
TOOKER GEMCITABINE RESISTANCE DN	122	84	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 UP	338	225	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF UP	418	282	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP	408	276	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
FONTAINE FOLLICULAR THYROID ADENOMA DN	68	45	All SZGR 2.0 genes in this pathway
FONTAINE PAPILLARY THYROID CARCINOMA UP	66	38	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER WITH BRCA1 MUTATED DN	9	5	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S1	237	159	All SZGR 2.0 genes in this pathway
GUTIERREZ MULTIPLE MYELOMA UP	35	24	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
DASU IL6 SIGNALING UP	59	44	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP	397	206	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS DN	213	127	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
HUANG GATA2 TARGETS UP	149	96	All SZGR 2.0 genes in this pathway
KRIEG KDM3A TARGETS NOT HYPOXIA	208	107	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38	337	236	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-133	1623	1630	1A,m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	1623	1630	1A,m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-135	3629	3635	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	3629	3635	m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-141/200a	3698	3704	m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	3698	3704	m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-142-5p	1843	1849	1A	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-142-5p	1843	1849	1A	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-145	3221	3227	m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-149	821	828	1A,m8	hsa-miR-149^brain	UCUGGCUCCGUGUCUUCACUCC
miR-155	3614	3620	m8	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-182	1595	1601	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-182	1595	1601	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-193	2270	2276	m8	hsa-miR-193a	AACUGGCCUACAAAGUCCCAG
miR-193	2270	2276	m8	hsa-miR-193b	AACUGGCCCUCAAAGUCCCGCUUU
miR-203.1	4029	4035	m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-21	3979	3985	1A	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	3979	3985	1A	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-214	1663	1670	1A,m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-324-3p	3782	3788	1A	hsa-miR-324-3p	CCACUGCCCCAGGUGCUGCUGG
miR-330	3875	3881	1A	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-34/449	3328	3334	1A	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-369-3p	3953	3959	1A	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	3953	3959	m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-383	944	950	m8	hsa-miR-383^brain	AGAUCAGAAGGUGAUUGUGGCU
miR-410	3955	3961	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-9	3796	3802	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-96	1595	1601	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CD47