Gene Page: CELSR1
Summary ?
GeneID | 9620 |
Symbol | CELSR1 |
Synonyms | ADGRC1|CDHF9|FMI2|HFMI2|ME2 |
Description | cadherin EGF LAG seven-pass G-type receptor 1 |
Reference | MIM:604523|HGNC:HGNC:1850|Ensembl:ENSG00000075275|HPRD:05160|Vega:OTTHUMG00000150423 |
Gene type | protein-coding |
Map location | 22q13.3 |
Pascal p-value | 0.73 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
CELSR1 | chr22 | 46859878 | G | A | NM_014246 | . | silent | Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg12216448 | 22 | 46759962 | CELSR1 | 4.649E-4 | 0.336 | 0.046 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2070396 | chr21 | 30878751 | CELSR1 | 9620 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PI4KA | 0.92 | 0.92 |
PIP4K2C | 0.92 | 0.90 |
STXBP1 | 0.92 | 0.92 |
SLC45A4 | 0.91 | 0.91 |
AMIGO1 | 0.91 | 0.91 |
GFOD1 | 0.91 | 0.90 |
STX1B | 0.91 | 0.90 |
IQSEC1 | 0.90 | 0.85 |
ATP2B3 | 0.90 | 0.90 |
MFSD6 | 0.90 | 0.92 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DBI | -0.52 | -0.63 |
MYL12A | -0.48 | -0.59 |
RAB13 | -0.48 | -0.55 |
RAB34 | -0.47 | -0.55 |
RHOC | -0.47 | -0.56 |
GNG11 | -0.46 | -0.57 |
C1orf61 | -0.46 | -0.61 |
PECI | -0.44 | -0.49 |
BTBD17 | -0.44 | -0.59 |
C1orf54 | -0.43 | -0.53 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004930 | G-protein coupled receptor activity | NAS | 9339365 | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0046983 | protein dimerization activity | NAS | 9339365 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007417 | central nervous system development | NAS | Brain (GO term level: 6) | 9339365 |
GO:0007417 | central nervous system development | TAS | Brain (GO term level: 6) | 10716726 |
GO:0007218 | neuropeptide signaling pathway | IEA | Neurotransmitter (GO term level: 8) | - |
GO:0001736 | establishment of planar polarity | ISS | - | |
GO:0001843 | neural tube closure | ISS | - | |
GO:0007156 | homophilic cell adhesion | IEA | - | |
GO:0007165 | signal transduction | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 9339365 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE DN | 84 | 53 | All SZGR 2.0 genes in this pathway |
DOANE BREAST CANCER ESR1 UP | 112 | 72 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
YANG BREAST CANCER ESR1 BULK UP | 27 | 15 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS DN | 411 | 249 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
CROMER METASTASIS UP | 79 | 46 | All SZGR 2.0 genes in this pathway |
CROMER METASTASIS DN | 81 | 58 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BRAIN DN | 85 | 58 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE UP | 97 | 61 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B UP | 172 | 109 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
ZHENG IL22 SIGNALING UP | 56 | 36 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
POOLA INVASIVE BREAST CANCER DN | 134 | 83 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA DN | 56 | 39 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
SERVITJA LIVER HNF1A TARGETS DN | 157 | 105 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-142-5p | 1886 | 1892 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-182 | 190 | 196 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-199 | 1949 | 1956 | 1A,m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC | ||||
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-26 | 598 | 605 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-96 | 189 | 196 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.