Gene Page: FEZ2
Summary ?
| GeneID | 9637 |
| Symbol | FEZ2 |
| Synonyms | HUM3CL |
| Description | fasciculation and elongation protein zeta 2 |
| Reference | MIM:604826|HGNC:HGNC:3660|Ensembl:ENSG00000171055|HPRD:09213|Vega:OTTHUMG00000152148 |
| Gene type | protein-coding |
| Map location | 2p21 |
| Pascal p-value | 0.076 |
| Sherlock p-value | 0.228 |
| Fetal beta | -0.815 |
| DMG | 1 (# studies) |
| eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg07234911 | 2 | 36825204 | FEZ2 | 1.38E-9 | -0.016 | 1.37E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SEC16A | 0.93 | 0.95 |
| ZFYVE26 | 0.92 | 0.94 |
| KIAA1310 | 0.92 | 0.94 |
| ANKFY1 | 0.91 | 0.94 |
| TRRAP | 0.91 | 0.94 |
| USP22 | 0.91 | 0.94 |
| TGFBRAP1 | 0.91 | 0.95 |
| CRAMP1L | 0.91 | 0.94 |
| HCFC1 | 0.91 | 0.92 |
| URB1 | 0.91 | 0.94 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.68 | -0.82 |
| MT-CO2 | -0.68 | -0.83 |
| AF347015.27 | -0.66 | -0.78 |
| FXYD1 | -0.65 | -0.79 |
| AF347015.33 | -0.64 | -0.76 |
| AF347015.8 | -0.64 | -0.81 |
| AF347015.21 | -0.64 | -0.88 |
| HIGD1B | -0.64 | -0.80 |
| IFI27 | -0.64 | -0.76 |
| MT-CYB | -0.64 | -0.77 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 14690447 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007411 | axon guidance | TAS | axon (GO term level: 13) | 9096408 |
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9096408 |
| GO:0007165 | signal transduction | TAS | 9096408 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
| WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| LANDIS BREAST CANCER PROGRESSION DN | 70 | 43 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA REVERSIBLY DN | 29 | 21 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| LANDIS ERBB2 BREAST TUMORS 324 DN | 149 | 93 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
| JAZAG TGFB1 SIGNALING UP | 108 | 69 | All SZGR 2.0 genes in this pathway |
| NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY NO BLOOD UP | 222 | 139 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
| LEIN CEREBELLUM MARKERS | 85 | 47 | All SZGR 2.0 genes in this pathway |
| FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
| SWEET KRAS ONCOGENIC SIGNATURE | 89 | 56 | All SZGR 2.0 genes in this pathway |
| DANG REGULATED BY MYC UP | 72 | 53 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 16 | 79 | 47 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-200bc/429 | 121 | 128 | 1A,m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.