SZGR2

Summary ?

GeneID	9685
Symbol	CLINT1
Synonyms	CLINT\|ENTH\|EPN4\|EPNR
Description	clathrin interactor 1
Reference	MIM:607265\|HGNC:HGNC:23186\|Ensembl:ENSG00000113282\|HPRD:06273\|Vega:OTTHUMG00000163527
Gene type	protein-coding
Map location	5q33.3
Pascal p-value	0.139
Sherlock p-value	0.078
Fetal beta	0.618
DMG	1 (# studies)
eGene	Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	3	Link to SZGene
GSMA_I	Genome scan meta-analysis	Psr: 0.0032
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01718
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00459
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg11669387	5	157285902	CLINT1	9.91E-8	-0.007	2.2E-5	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs2403775	chr8	133472361	CLINT1	9685		0.13		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SNAP91	0.94	0.95
WDR7	0.93	0.92
PRKAR1A	0.92	0.92
ATP6V1A	0.92	0.92
PNMA2	0.91	0.92
PLEKHB2	0.90	0.91
USP32	0.90	0.90
RTN3	0.90	0.89
CLTC	0.90	0.90
KIAA1467	0.90	0.91

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RAB34	-0.57	-0.63
C1orf61	-0.55	-0.67
ACSF2	-0.53	-0.54
AP002478.3	-0.52	-0.56
AF347015.21	-0.52	-0.48
EIF4EBP3	-0.51	-0.56
PLA2G5	-0.51	-0.45
C1orf54	-0.51	-0.54
HIGD1B	-0.51	-0.48
AC098691.2	-0.50	-0.53

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		14675752
GO:0008289	lipid binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006897	endocytosis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005794	Golgi apparatus	IDA		10942595
GO:0005737	cytoplasm	IEA		-
GO:0016020	membrane	IEA		-
GO:0031410	cytoplasmic vesicle	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
LAIHO COLORECTAL CANCER SERRATED UP	112	71	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN	384	230	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
BARRIER CANCER RELAPSE NORMAL SAMPLE UP	32	21	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN	546	351	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR	544	307	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D4	55	37	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR UP	156	101	All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION DN	98	67	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C5	46	36	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3	720	440	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR UP	294	199	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
PHESSE TARGETS OF APC AND MBD2 UP	20	14	All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN	187	109	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 36HR	29	23	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-137	1007	1013	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-145	545	552	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-155	1134	1140	1A	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-221/222	1057	1063	1A	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	1057	1063	1A	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-33	1173	1179	1A	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	1173	1179	1A	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-433-3p	1153	1159	m8	hsa-miR-433^brain	AUCAUGAUGGGCUCCUCGGUGU
miR-505	1265	1271	1A	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CLINT1