Summary ?
GeneID9686
SymbolVGLL4
SynonymsVGL-4
Descriptionvestigial like family member 4
ReferenceHGNC:HGNC:28966|Ensembl:ENSG00000144560|HPRD:11672|Vega:OTTHUMG00000129739
Gene typeprotein-coding
Map location3p25.3
Pascal p-value0.011
Sherlock p-value0.003
Fetal beta0.25
DMG3 (# studies)
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 5
DMG:vanEijk_2014Genome-wide DNA methylation analysisThis dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 5
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 5
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IGenome scan meta-analysisPsr: 0.006 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg24139835311607118VGLL41.813E-40.4130.034DMG:Wockner_2014
cg05575304311607115VGLL44.258E-40.4360.045DMG:Wockner_2014
cg25678292311684193VGLL48.13E-9-0.0153.86E-6DMG:Jaffe_2016
cg16184035311684116VGLL48.76E-8-0.0132.01E-5DMG:Jaffe_2016
cg04172348312046004VGLL40.0033.363DMG:vanEijk_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs1572945chr158069522VGLL496860.19trans
rs2797260chr1215904656VGLL496860.09trans
rs6733654chr21963270VGLL496860trans
rs13418573chr2205418512VGLL496860.07trans
rs16827037chr3117203284VGLL496860.01trans
rs16838645chr46370354VGLL496860.18trans
rs9397453chr6152236878VGLL496860.03trans
rs320082chr729105404VGLL496868.045E-4trans
rs317720chr729110633VGLL496860.05trans
rs317714chr729115553VGLL496860trans
rs317724chr729120565VGLL496860.05trans
rs1831517chr92513405VGLL496860.16trans
rs7020469chr927338005VGLL496860.01trans
rs947625chr9130774523VGLL496860.09trans
rs3025425chr9136523165VGLL496860.02trans
rs4607971chr1019407890VGLL496860.11trans
rs11203077chr1091097084VGLL496860.14trans
rs2935709chr10123490988VGLL496860.17trans
rs10834670chr1125404015VGLL496860.11trans
snp_a-20678120VGLL496860.11trans
rs11066476chr12113465366VGLL496860.19trans
rs11158850chr1470757171VGLL496860.07trans
rs4904626chr1490335051VGLL496860.06trans
rs1286939chr1490341837VGLL496860.06trans
rs12452652chr1772235560VGLL496860.05trans
rs10502875chr1844241477VGLL496860.16trans
rs9637082chr2121213235VGLL496860trans
rs5755349chr2235225459VGLL496860.18trans
rs9619990chr2242163258VGLL496860.13trans
rs8141783chr2242179110VGLL496860.2trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
ZFYVE210.670.71
TAP20.660.69
C14orf1590.640.70
HS1BP30.640.69
OAS30.630.67
TRIM250.630.72
GRIK40.630.70
RETSAT0.620.67
PYCR20.620.70
C10orf720.610.62
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
RBMX2-0.38-0.44
FAM159B-0.37-0.47
RP9P-0.36-0.46
C21orf57-0.36-0.39
HDAC2-0.35-0.17
SNRPG-0.34-0.41
H2AFY2-0.33-0.12
RPL35A-0.33-0.42
RPS3AP47-0.33-0.33
ZNF738-0.33-0.20

Section III. Gene Ontology annotation

Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
ZHOU INFLAMMATORY RESPONSE LIVE DN 384220All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP 372227All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS RED DN 2519All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 DN 281186All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN 284156All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN 329219All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805505All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537339All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS UP 194112All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN 800473All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS UP 380213All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769437All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037673All SZGR 2.0 genes in this pathway
LIAO HAVE SOX4 BINDING SITES 4026All SZGR 2.0 genes in this pathway
LIAO METASTASIS 539324All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED 10068All SZGR 2.0 genes in this pathway
HOEGERKORP CD44 TARGETS TEMPORAL UP 138All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 16911088All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C5 4636All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3 491310All SZGR 2.0 genes in this pathway
RUIZ TNC TARGETS UP 153107All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3 445257All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 2HR DN 5535All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN 11469All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/20612761282m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-124.1245424601Ahsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-130/3014784851A,m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-1343243311A,m8hsa-miR-134brainUGUGACUGGUUGACCAGAGGG
miR-135331337m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-181181918251Ahsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-19477483m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-221/22218741880m8hsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-328126112671Ahsa-miR-328brainCUGGCCCUCUCUGCCCUUCCGU
miR-33048541Ahsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-365732738m8hsa-miR-365UAAUGCCCCUAAAAAUCCUUAU
miR-384175117571Ahsa-miR-384AUUCCUAGAAAUUGUUCAUA
miR-48821952201m8hsa-miR-488CCCAGAUAAUGGCACUCUCAA
miR-493-5p18211827m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-495186218681Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-5393193251Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-92612681A,m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA