SZGR2

Summary ?

GeneID	9759
Symbol	HDAC4
Synonyms	AHO3\|BDMR\|HA6116\|HD4\|HDAC-4\|HDAC-A\|HDACA
Description	histone deacetylase 4
Reference	MIM:605314\|HGNC:HGNC:14063\|Ensembl:ENSG00000068024\|HPRD:05610\|Vega:OTTHUMG00000133344
Gene type	protein-coding
Map location	2q37.3
Pascal p-value	0.717
Sherlock p-value	0.376
Fetal beta	0.386
DMG	2 (# studies)
eGene	Myers' cis & trans
Support	CompositeSet Darnell FMRP targets Ascano FMRP targets Chromatin Remodeling Genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	4
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	4
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg15929228	2	240323491	HDAC4	1.976E-4	-0.296	0.035	DMG:Wockner_2014
cg17356718	2	240230587	HDAC4	3.267E-4	0.33	0.04	DMG:Wockner_2014
cg14273620	2	240170857	HDAC4	3.668E-4	0.305	0.042	DMG:Wockner_2014
cg15142485	2	240323713	HDAC4	7.55E-9	-0.01	3.72E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs17007452	chr12	81243404	HDAC4	9759		0.17		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AATK	0.87	0.75
TMEM184B	0.86	0.85
FAM78A	0.85	0.82
ABCA2	0.85	0.81
TNK2	0.84	0.78
NAT8L	0.84	0.80
NCKIPSD	0.83	0.79
IPO13	0.83	0.83
MAN2A2	0.83	0.76
SLC6A8	0.83	0.83

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ST20	-0.45	-0.52
C9orf46	-0.44	-0.50
RP9P	-0.43	-0.56
FAM36A	-0.42	-0.41
RPL35	-0.42	-0.49
RPL24	-0.42	-0.49
RPL31	-0.41	-0.48
GTF3C6	-0.41	-0.42
SNRPG	-0.41	-0.53
RPL13AP22	-0.41	-0.62

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0004407	histone deacetylase activity	NAS		10523670
GO:0016787	hydrolase activity	IEA		-
GO:0008134	transcription factor binding	TAS		12711221
GO:0016564	transcription repressor activity	IEA		-
GO:0016564	transcription repressor activity	TAS		10523670
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	12711221
GO:0000122	negative regulation of transcription from RNA polymerase II promoter	IEA		-
GO:0001501	skeletal system development	IEA		-
GO:0006350	transcription	IEA		-
GO:0007049	cell cycle	NAS		-
GO:0008285	negative regulation of cell proliferation	IEA		-
GO:0006954	inflammatory response	TAS		12711221
GO:0007275	multicellular organismal development	NAS		-
GO:0016568	chromatin modification	TAS		12711221
GO:0030183	B cell differentiation	TAS		12711221
GO:0045843	negative regulation of striated muscle development	TAS		12711221
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000118	histone deacetylase complex	TAS		12711221
GO:0005634	nucleus	NAS		-
GO:0005737	cytoplasm	TAS		12711221

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ANKRD11	ANCO-1 \| LZ16 \| T13	ankyrin repeat domain 11	-	HPRD	15184363
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Reconstituted Complex	BioGRID	12943985
BCL6	BCL5 \| BCL6A \| LAZ3 \| ZBTB27 \| ZNF51	B-cell CLL/lymphoma 6	-	HPRD,BioGRID	11929873
BCOR	ANOP2 \| FLJ20285 \| FLJ38041 \| KIAA1575 \| MAA2 \| MCOPS2 \| MGC131961 \| MGC71031	BCL6 co-repressor	-	HPRD,BioGRID	10898795
CBX5	HP1 \| HP1A	chromobox homolog 5 (HP1 alpha homolog, Drosophila)	-	HPRD,BioGRID	12242305
CTBP1	BARS \| MGC104684	C-terminal binding protein 1	Reconstituted Complex	BioGRID	11022042
EVI1	AML1-EVI-1 \| EVI-1 \| MDS1-EVI1 \| MGC163392 \| PRDM3	ecotropic viral integration site 1	-	HPRD,BioGRID	11568182
GATA1	ERYF1 \| GF-1 \| GF1 \| NFE1	GATA binding protein 1 (globin transcription factor 1)	Affinity Capture-Western Reconstituted Complex	BioGRID	14668799
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	-	HPRD	11804585
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	-	HPRD,BioGRID	11466315
HDAC4	HA6116 \| HD4 \| HDAC-A \| HDACA \| KIAA0288	histone deacetylase 4	Reconstituted Complex	BioGRID	11486037
HDAC9	DKFZp779K1053 \| HD7 \| HDAC \| HDAC7 \| HDAC7B \| HDAC9B \| HDAC9FL \| HDRP \| KIAA0744 \| MITR	histone deacetylase 9	-	HPRD,BioGRID	12590135
IKZF1	Hs.54452 \| IK1 \| IKAROS \| LYF1 \| PRO0758 \| ZNFN1A1 \| hIk-1	IKAROS family zinc finger 1 (Ikaros)	Affinity Capture-Western	BioGRID	12015313
IKZF2	HELIOS \| MGC34330 \| ZNF1A2 \| ZNFN1A2	IKAROS family zinc finger 2 (Helios)	Reconstituted Complex	BioGRID	12943985
IKZF3	AIO \| AIOLOS \| ZNFN1A3	IKAROS family zinc finger 3 (Aiolos)	Affinity Capture-Western	BioGRID	12015313
IKZF4	EOS \| KIAA1782 \| ZNFN1A4	IKAROS family zinc finger 4 (Eos)	Affinity Capture-Western	BioGRID	12015313
MAPK1	ERK \| ERK2 \| ERT1 \| MAPK2 \| P42MAPK \| PRKM1 \| PRKM2 \| p38 \| p40 \| p41 \| p41mapk	mitogen-activated protein kinase 1	-	HPRD,BioGRID	11114188
MAPK3	ERK1 \| HS44KDAP \| HUMKER1A \| MGC20180 \| P44ERK1 \| P44MAPK \| PRKM3	mitogen-activated protein kinase 3	-	HPRD,BioGRID	11114188
MEF2A	ADCAD1 \| RSRFC4 \| RSRFC9	myocyte enhancer factor 2A	-	HPRD,BioGRID	10487761
MEF2C	-	myocyte enhancer factor 2C	-	HPRD	10523670 \|11504882
MEF2C	-	myocyte enhancer factor 2C	Affinity Capture-Western Reconstituted Complex	BioGRID	10523670 \|11486037
MEF2D	DKFZp686I1536	myocyte enhancer factor 2D	-	HPRD,BioGRID	10523670
MEGF10	DKFZp781K1852 \| FLJ41574 \| KIAA1780	multiple EGF-like-domains 10	-	HPRD	12421765
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	-	HPRD	10944117 \|11804585
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	Affinity Capture-Western Reconstituted Complex	BioGRID	10640275 \|11804585
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	-	HPRD,BioGRID	11804585
NR2C1	TR2	nuclear receptor subfamily 2, group C, member 1	-	HPRD,BioGRID	11463856 \|12943985
NR2C2	TAK1 \| TR2R1 \| TR4 \| hTAK1	nuclear receptor subfamily 2, group C, member 2	Reconstituted Complex	BioGRID	12943985
PPARD	FAAR \| MGC3931 \| NR1C2 \| NUC1 \| NUCI \| NUCII \| PPAR-beta \| PPARB	peroxisome proliferator-activated receptor delta	Reconstituted Complex	BioGRID	12943985
PPARG	NR1C3 \| PPARG1 \| PPARG2 \| PPARgamma	peroxisome proliferator-activated receptor gamma	Reconstituted Complex	BioGRID	12943985
RARA	NR1B1 \| RAR	retinoic acid receptor, alpha	Reconstituted Complex	BioGRID	12943985
RBBP4	NURF55 \| RBAP48	retinoblastoma binding protein 4	Affinity Capture-Western	BioGRID	10220385
RUNX3	AML2 \| CBFA3 \| FLJ34510 \| MGC16070 \| PEBP2aC	runt-related transcription factor 3	-	HPRD	15138260
RUVBL2	CGI-46 \| ECP51 \| INO80J \| REPTIN \| RVB2 \| TIH2 \| TIP48 \| TIP49B	RuvB-like 2 (E. coli)	RUVBL2 (reptin) interacts with HDAC4.	BIND	15829968
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	Reconstituted Complex	BioGRID	12943985
SFN	YWHAS	stratifin	Affinity Capture-MS	BioGRID	15778465
SUMO2	HSMT3 \| MGC117191 \| SMT3B \| SMT3H2	SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)	-	HPRD	11451954
SUV39H1	KMT1A \| MG44 \| SUV39H	suppressor of variegation 3-9 homolog 1 (Drosophila)	Affinity Capture-Western	BioGRID	12242305
TNFRSF14	ATAR \| HVEA \| HVEM \| LIGHTR \| TR2	tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)	-	HPRD	11463856
TNFSF10	APO2L \| Apo-2L \| CD253 \| TL2 \| TRAIL	tumor necrosis factor (ligand) superfamily, member 10	HDAC4 interacts with the TNFSF10 promoter.	BIND	15619633
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	Biochemical Activity	BioGRID	18691969
YWHAB	GW128 \| HS1 \| KCIP-1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide	Affinity Capture-Western	BioGRID	10869435
YWHAE	14-3-3E \| FLJ45465 \| KCIP-1 \| MDCR \| MDS	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide	Affinity Capture-Western Reconstituted Complex	BioGRID	10869435 \|11504882
YWHAE	14-3-3E \| FLJ45465 \| KCIP-1 \| MDCR \| MDS	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide	-	HPRD	11486037
YWHAG	14-3-3GAMMA	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide	Reconstituted Complex	BioGRID	11504882
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	Reconstituted Complex	BioGRID	11504882
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	-	HPRD	11486037
ZBTB16	PLZF \| ZNF145	zinc finger and BTB domain containing 16	-	HPRD,BioGRID	11929873 \|15467736
ZNF354A	EZNF \| HKL1 \| KID-1 \| KID1 \| TCF17	zinc finger protein 354A	Reconstituted Complex	BioGRID	12943985

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA CARM ER PATHWAY	35	27	All SZGR 2.0 genes in this pathway
PID HDAC CLASSII PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID HDAC CLASSIII PATHWAY	25	20	All SZGR 2.0 genes in this pathway
PID HDAC CLASSI PATHWAY	66	50	All SZGR 2.0 genes in this pathway
PID RANBP2 PATHWAY	11	11	All SZGR 2.0 genes in this pathway
PID ERA GENOMIC PATHWAY	65	37	All SZGR 2.0 genes in this pathway
REACTOME NOTCH1 INTRACELLULAR DOMAIN REGULATES TRANSCRIPTION	46	28	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH1	70	46	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH	103	64	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
ZHONG RESPONSE TO AZACITIDINE AND TSA DN	70	38	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
CASORELLI APL SECONDARY VS DE NOVO UP	39	25	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN	384	230	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP DN	199	124	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 UP	108	66	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN	411	249	All SZGR 2.0 genes in this pathway
PEART HDAC PROLIFERATION CLUSTER DN	76	57	All SZGR 2.0 genes in this pathway
MEDINA SMARCA4 TARGETS	44	29	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
BERNARD PPAPDC1B TARGETS DN	58	39	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP	260	174	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE	200	115	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP	281	183	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP	570	339	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	3547	3553	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
				hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-10	2434	2441	1A,m8	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	2434	2441	1A,m8	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-122	2929	2935	1A	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-124.1	734	741	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	734	740	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-138	3280	3287	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-140	453	459	m8	hsa-miR-140^brain	AGUGGUUUUACCCUAUGGUAG
miR-141/200a	1056	1063	1A,m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	1056	1063	1A,m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-142-5p	3692	3699	1A,m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-155	2955	2961	m8	hsa-miR-155	UUAAUGCUAAUCGUGAUAGGGG
miR-17-5p/20/93.mr/106/519.d	3169	3176	1A,m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-19	3712	3718	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	3712	3718	m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-200bc/429	1890	1896	1A	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-205	3822	3828	1A	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-22	3728	3734	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-29	410	416	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-299-5p	451	458	1A,m8	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU
miR-320	3730	3736	m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-365	3591	3597	m8	hsa-miR-365	UAAUGCCCCUAAAAAUCCUUAU
miR-370	3283	3289	m8	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG
miR-409-3p	3513	3519	m8	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU
miR-455	1477	1483	1A	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG
miR-485-3p	1534	1541	1A,m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU
miR-9	2064	2070	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-93.hd/291-3p/294/295/302/372/373/520	3168	3174	m8	hsa-miR-93^brain	AAAGUGCUGUUCGUGCAGGUAG
				hsa-miR-302a	UAAGUGCUUCCAUGUUUUGGUGA
				hsa-miR-302b	UAAGUGCUUCCAUGUUUUAGUAG
				hsa-miR-302c	UAAGUGCUUCCAUGUUUCAGUGG
				hsa-miR-302d	UAAGUGCUUCCAUGUUUGAGUGU
				hsa-miR-372	AAAGUGCUGCGACAUUUGAGCGU
				hsa-miR-373	GAAGUGCUUCGAUUUUGGGGUGU
				hsa-miR-520e	AAAGUGCUUCCUUUUUGAGGG
				hsa-miR-520a	AAAGUGCUUCCCUUUGGACUGU
				hsa-miR-520b	AAAGUGCUUCCUUUUAGAGGG
				hsa-miR-520c	AAAGUGCUUCCUUUUAGAGGGUU
				hsa-miR-520d	AAAGUGCUUCUCUUUGGUGGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HDAC4