SZGR2

Summary ?

GeneID	9882
Symbol	TBC1D4
Synonyms	AS160\|NIDDM5
Description	TBC1 domain family member 4
Reference	MIM:612465\|HGNC:HGNC:19165\|Ensembl:ENSG00000136111\|HPRD:18164\|Vega:OTTHUMG00000017088
Gene type	protein-coding
Map location	13q22.2
Pascal p-value	0.285
Sherlock p-value	0.444
Fetal beta	-0.658
DMG	1 (# studies)
eGene	Cerebellum Cortex Myers' cis & trans
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
TBC1D4	chr13	76055883	A	G	NM_014832	.	silent			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg17878506	13	76056784	TBC1D4	2.037E-4	-0.364	0.035	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs2256500	chr1	17890573	TBC1D4	9882		0.19		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MTMR6	0.89	0.89
ARL1	0.89	0.90
TSNAX	0.88	0.89
IMPA1	0.88	0.90
SPTLC1	0.86	0.87
C6orf211	0.86	0.89
DNAJB9	0.86	0.89
PPP3R1	0.86	0.89
EFHA2	0.85	0.90
ARL8B	0.85	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AL022328.1	-0.51	-0.57
ZNF814	-0.46	-0.52
AC006028.3	-0.46	-0.50
C16orf79	-0.45	-0.49
AC010300.1	-0.44	-0.47
DMPK	-0.44	-0.43
NPIP	-0.43	-0.43
IL3RA	-0.43	-0.57
WDR86	-0.43	-0.42
SMTN	-0.42	-0.45

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
C12orf35	FLJ10652 \| FLJ20696	chromosome 12 open reading frame 35	-	HPRD	12421765
C3orf63	DKFZp686C2456 \| KIAA1105 \| RAP140 \| se89-1	chromosome 3 open reading frame 63	-	HPRD	12421765
CDK5RAP2	C48 \| Cep215 \| DKFZp686B1070 \| DKFZp686D1070 \| KIAA1633 \| MCPH3	CDK5 regulatory subunit associated protein 2	-	HPRD	12421765
DNPEP	ASPEP \| DAP	aspartyl aminopeptidase	Affinity Capture-MS	BioGRID	17353931
EP400	CAGH32 \| DKFZP434I225 \| FLJ42018 \| FLJ45115 \| P400 \| TNRC12	E1A binding protein p400	-	HPRD	12421765
KIAA0556	-	KIAA0556	-	HPRD	12421765
NAV1	DKFZp781D0314 \| FLJ12560 \| FLJ14203 \| KIAA1151 \| MGC14961 \| POMFIL3 \| steerin-1	neuron navigator 1	-	HPRD	12421765
NFAT5	KIAA0827 \| NF-AT5 \| NFATL1 \| NFATZ \| OREBP \| TONEBP	nuclear factor of activated T-cells 5, tonicity-responsive	-	HPRD	12421765
RBM12	HRIHFB2091 \| KIAA0765 \| SWAN	RNA binding motif protein 12	-	HPRD	12421765
TOPBP1	TOP2BP1	topoisomerase (DNA) II binding protein 1	-	HPRD	12421765
ZMIZ1	FLJ13541 \| KIAA1224 \| MIZ \| RAI17 \| Zimp10 \| hZIMP10	zinc finger, MIZ-type containing 1	-	HPRD	12421765

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID INSULIN GLUCOSE PATHWAY	26	24	All SZGR 2.0 genes in this pathway
PID PI3KCI AKT PATHWAY	35	30	All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER UP	96	57	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP	579	346	All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN	663	425	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN	320	184	All SZGR 2.0 genes in this pathway
RHEIN ALL GLUCOCORTICOID THERAPY DN	362	238	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
PROVENZANI METASTASIS DN	136	94	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN	232	154	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 UP	121	71	All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 AND DCC TARGETS	35	25	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
KIM GERMINAL CENTER T HELPER UP	66	42	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN	371	218	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE DN	261	183	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO CSF2RB AND IL4 UP	338	225	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF UP	418	282	All SZGR 2.0 genes in this pathway
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN	245	150	All SZGR 2.0 genes in this pathway
LEE EARLY T LYMPHOCYTE DN	57	36	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE DN	181	97	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP	279	155	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-138	761	767	1A	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-181	431	438	1A,m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-23	1097	1103	1A	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1097	1103	1A	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-26	418	425	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	418	425	1A,m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-433-3p	307	313	1A	hsa-miR-433^brain	AUCAUGAUGGGCUCCUCGGUGU
miR-493-5p	212	218	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-9	448	454	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TBC1D4