Gene Page: SEPT7
Summary ?
| GeneID | 989 |
| Symbol | SEPT7 |
| Synonyms | CDC10|CDC3|NBLA02942|SEPT7A |
| Description | septin 7 |
| Reference | MIM:603151|HGNC:HGNC:1717|Ensembl:ENSG00000122545|HPRD:04398|Vega:OTTHUMG00000155063 |
| Gene type | protein-coding |
| Map location | 7p14.2 |
| Pascal p-value | 0.057 |
| Sherlock p-value | 0.46 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
| Support | PROTEIN CLUSTERING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_mGluR5 G2Cdb.human_Synaptosome G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg21815536 | 7 | 35840623 | SEPT7 | 2.979E-4 | -0.216 | 0.039 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs9882137 | chr3 | 29494146 | SEPT7 | 989 | 0.03 | trans | ||
| rs9882501 | chr3 | 29494429 | SEPT7 | 989 | 0.1 | trans | ||
| rs4491879 | chr3 | 189373908 | SEPT7 | 989 | 0.1 | trans | ||
| rs4505678 | chr3 | 189374356 | SEPT7 | 989 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| WDR62 | 0.83 | 0.73 |
| RAD54L | 0.81 | 0.57 |
| E2F1 | 0.81 | 0.78 |
| SPAG5 | 0.80 | 0.63 |
| GSX2 | 0.80 | 0.23 |
| NCAPD2 | 0.79 | 0.55 |
| NOTCH1 | 0.79 | 0.56 |
| SALL1 | 0.79 | 0.69 |
| CDT1 | 0.79 | 0.46 |
| MCM3 | 0.79 | 0.68 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.21 | -0.35 | -0.30 |
| AF347015.31 | -0.31 | -0.25 |
| IL32 | -0.30 | -0.34 |
| AF347015.8 | -0.30 | -0.23 |
| AF347015.18 | -0.30 | -0.25 |
| MT-CO2 | -0.30 | -0.23 |
| SYCP3 | -0.29 | -0.33 |
| C1orf54 | -0.28 | -0.26 |
| MT-ATP8 | -0.28 | -0.23 |
| MT-CYB | -0.27 | -0.20 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 15485874 | |
| GO:0005525 | GTP binding | IEA | - | |
| GO:0005525 | GTP binding | TAS | 8037772 | |
| GO:0005198 | structural molecule activity | TAS | 8037772 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000910 | cytokinesis | TAS | 8037772 | |
| GO:0007049 | cell cycle | IEA | - | |
| GO:0051291 | protein heterooligomerization | IDA | 15485874 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0019717 | synaptosome | IEA | Synap, Brain (GO term level: 7) | - |
| GO:0001725 | stress fiber | IDA | 15485874 | |
| GO:0005634 | nucleus | IDA | 15485874 | |
| GO:0031105 | septin complex | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| WATANABE COLON CANCER MSI VS MSS DN | 81 | 42 | All SZGR 2.0 genes in this pathway |
| CHANDRAN METASTASIS TOP50 UP | 38 | 27 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE DN | 244 | 147 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| CALVET IRINOTECAN SENSITIVE VS RESISTANT DN | 5 | 5 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| ZHANG RESPONSE TO IKK INHIBITOR AND TNF DN | 103 | 64 | All SZGR 2.0 genes in this pathway |
| NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
| STONER ESOPHAGEAL CARCINOGENESIS UP | 39 | 25 | All SZGR 2.0 genes in this pathway |
| IGLESIAS E2F TARGETS UP | 151 | 103 | All SZGR 2.0 genes in this pathway |
| MURAKAMI UV RESPONSE 6HR UP | 37 | 31 | All SZGR 2.0 genes in this pathway |
| MA PITUITARY FETAL VS ADULT UP | 29 | 21 | All SZGR 2.0 genes in this pathway |
| JIANG AGING CEREBRAL CORTEX DN | 54 | 43 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
| MCCABE HOXC6 TARGETS UP | 10 | 8 | All SZGR 2.0 genes in this pathway |
| MCCABE HOXC6 TARGETS CANCER UP | 31 | 23 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
| LEE LIVER CANCER SURVIVAL DN | 175 | 103 | All SZGR 2.0 genes in this pathway |
| WENDT COHESIN TARGETS UP | 33 | 19 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA | 43 | 27 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA CHEMOTAXIS UP | 74 | 45 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
| CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
| MURAKAMI UV RESPONSE 1HR UP | 17 | 10 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 ISOFORM A | 182 | 108 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-127 | 67 | 73 | m8 | hsa-miR-127brain | UCGGAUCCGUCUGAGCUUGGCU |
| miR-141/200a | 56 | 62 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-149 | 630 | 636 | 1A | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
| miR-182 | 32 | 38 | m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-183 | 369 | 375 | 1A | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
| miR-186 | 590 | 597 | 1A,m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-19 | 83 | 89 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-216 | 155 | 161 | 1A | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
| miR-219 | 288 | 294 | 1A | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
| miR-24* | 819 | 825 | 1A | hsa-miR-189 | GUGCCUACUGAGCUGAUAUCAGU |
| miR-30-5p | 312 | 319 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-325 | 879 | 885 | 1A | hsa-miR-325 | CCUAGUAGGUGUCCAGUAAGUGU |
| miR-33 | 262 | 268 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
| miR-335 | 901 | 907 | 1A | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
| miR-376 | 397 | 403 | m8 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
| hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
| miR-452 | 382 | 388 | m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
| miR-493-5p | 285 | 291 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-495 | 575 | 581 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU | ||||
| hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.