Summary ?
GeneID9892
SymbolSNAP91
SynonymsAP180|CALM
Descriptionsynaptosome associated protein 91kDa
ReferenceMIM:607923|HGNC:HGNC:14986|Ensembl:ENSG00000065609|HPRD:06391|Vega:OTTHUMG00000015114
Gene typeprotein-coding
Map location6q14.2
Pascal p-value7.241E-9
Sherlock p-value0.678
Fetal beta-1.282
DMG1 (# studies)
eGeneMyers' cis & trans
SupportENDOCYTOSIS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
G2Cdb.human_clathrin
G2Cdb.human_Synaptosome
CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGC128Genome-wide Association StudyA multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@CV:PGC128

SNP IDChromosomePositionAllelePFunctionGeneUp/Down Distance

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg21688264684418724SNAP911.412E-4-0.3010.031DMG:Wockner_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs10994209chr1061877705SNAP9198920.2trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0030276clathrin bindingIEASynap (GO term level: 4)-
GO:0005543phospholipid bindingIEA-
GO:0005545phosphatidylinositol bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0048268clathrin coat assemblyIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0030118clathrin coatIEA-
GO:0005905coated pitIEA-
GO:0005886plasma membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP 428266All SZGR 2.0 genes in this pathway
XU GH1 EXOGENOUS TARGETS DN 12069All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP 756494All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS DN 11573All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A 898516All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN 448282All SZGR 2.0 genes in this pathway
MADAN DPPA4 TARGETS 4626All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-141/200a11481154m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-14410871093m8hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-2211661172m8hsa-miR-22brainAAGCUGCCAGUUGAAGAACUGU
miR-25/32/92/363/367138013861Ahsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-38431371Ahsa-miR-384AUUCCUAGAAAUUGUUCAUA