Gene Page: ARNT2
Summary ?
GeneID | 9915 |
Symbol | ARNT2 |
Synonyms | WEDAS|bHLHe1 |
Description | aryl hydrocarbon receptor nuclear translocator 2 |
Reference | MIM:606036|HGNC:HGNC:16876|Ensembl:ENSG00000172379|Vega:OTTHUMG00000165478 |
Gene type | protein-coding |
Map location | 15q24 |
Pascal p-value | 0.123 |
Sherlock p-value | 0.167 |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:McCarthy_2014 | Whole Exome Sequencing analysis | Whole exome sequencing of 57 trios with sporadic or familial schizophrenia. | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
ARNT2 | chr15 | 80873690 | C | G | NM_014862 | p.T621T | synonymous SNV | Schizophrenia | DNM:McCarthy_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RP11-23D24.1 | 0.79 | 0.76 |
ANO6 | 0.78 | 0.81 |
ITPR2 | 0.76 | 0.80 |
PDLIM5 | 0.76 | 0.73 |
ITGA6 | 0.75 | 0.76 |
PCDHGC3 | 0.74 | 0.75 |
CDGAP | 0.74 | 0.76 |
LAMA4 | 0.73 | 0.73 |
RAB31 | 0.73 | 0.70 |
AP000872.1 | 0.72 | 0.80 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TIMM10 | -0.34 | -0.34 |
A1BG | -0.32 | -0.36 |
USMG5 | -0.31 | -0.29 |
C17orf61 | -0.31 | -0.32 |
DDTL | -0.31 | -0.29 |
NDUFB1 | -0.31 | -0.26 |
MRPL21 | -0.31 | -0.37 |
BLOC1S1 | -0.30 | -0.29 |
NDUFA2 | -0.30 | -0.32 |
AL353354.3 | -0.30 | -0.15 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004871 | signal transducer activity | IEA | - | |
GO:0003700 | transcription factor activity | ISS | - | |
GO:0017162 | aryl hydrocarbon receptor binding | ISS | - | |
GO:0046982 | protein heterodimerization activity | IPI | 12239177 | |
GO:0046982 | protein heterodimerization activity | ISS | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007417 | central nervous system development | ISS | Brain (GO term level: 6) | - |
GO:0001666 | response to hypoxia | IDA | 12239177 | |
GO:0001701 | in utero embryonic development | ISS | - | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0007165 | signal transduction | IEA | - | |
GO:0045941 | positive regulation of transcription | ISS | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 12239177 | |
GO:0005667 | transcription factor complex | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG RENAL CELL CARCINOMA | 70 | 60 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER BASAL VS MESENCHYMAL DN | 50 | 36 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS D UP | 38 | 23 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION 12HR | 43 | 35 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
SILIGAN BOUND BY EWS FLT1 FUSION | 47 | 34 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
RICKMAN HEAD AND NECK CANCER A | 100 | 63 | All SZGR 2.0 genes in this pathway |
SHEPARD CRUSH AND BURN MUTANT DN | 185 | 111 | All SZGR 2.0 genes in this pathway |
FRASOR RESPONSE TO ESTRADIOL DN | 82 | 52 | All SZGR 2.0 genes in this pathway |
SASAKI ADULT T CELL LEUKEMIA | 176 | 122 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA LB UP | 48 | 28 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 8WK | 47 | 38 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 6HR DN | 160 | 101 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY 4NQO OR UV | 63 | 44 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN LIVER DN | 10 | 9 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B UP | 172 | 109 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
BOSCO TH1 CYTOTOXIC MODULE | 114 | 62 | All SZGR 2.0 genes in this pathway |
DURAND STROMA NS UP | 162 | 103 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-181 | 4128 | 4134 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-34b | 4187 | 4193 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
miR-543 | 4129 | 4135 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.