Summary ?
GeneID9956
SymbolHS3ST2
Synonyms30ST2|3OST2
Descriptionheparan sulfate-glucosamine 3-sulfotransferase 2
ReferenceMIM:604056|HGNC:HGNC:5195|Ensembl:ENSG00000122254|HPRD:04957|Vega:OTTHUMG00000094785
Gene typeprotein-coding
Map location16p12
Pascal p-value0.754
Sherlock p-value0.544
Fetal beta-1.961
DMG1 (# studies)
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg274032651622825621HS3ST25.26E-5-0.1860.022DMG:Wockner_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs2239335chr1622897794HS3ST299560.01cis
rs2369690chr1622920851HS3ST299560cis
rs6669846chr19650570HS3ST299560.1trans
rs11127467chr212993HS3ST299560.02trans
rs921163chr2205337399HS3ST299560trans
rs13003798chr2205355767HS3ST299560trans
rs6746267chr2205612604HS3ST299560.17trans
rs16863576chr2223120977HS3ST299560.11trans
rs17635521chr327813669HS3ST299560.15trans
rs9882574chr356944018HS3ST299560.14trans
rs9862967chr356944181HS3ST299560.14trans
rs9825359chr356944297HS3ST299560.14trans
rs9828029chr356949706HS3ST299560.12trans
rs1392700chr356952899HS3ST299560.14trans
rs12489848chr360399321HS3ST299560.18trans
rs16827037chr3117203284HS3ST299561.087E-4trans
rs6834153chr48606484HS3ST299560.01trans
rs17511050chr4133842650HS3ST299560.06trans
rs7664027chr4169121200HS3ST299560.02trans
rs17053782chr4169127022HS3ST299560.02trans
rs11722969chr4169133757HS3ST299560.02trans
rs6846811chr4169234535HS3ST299560.02trans
rs6894161chr591098032HS3ST299560.02trans
rs3861862chr5141842691HS3ST299560.12trans
rs17109939chr5148694416HS3ST299560.04trans
rs9397453chr6152236878HS3ST299560.2trans
rs887719chr721184272HS3ST299561.015E-4trans
rs320082chr729105404HS3ST299563.005E-6trans
rs317720chr729110633HS3ST299563.807E-4trans
rs317714chr729115553HS3ST299561.935E-7trans
rs317724chr729120565HS3ST299563.807E-4trans
rs1419793chr734697630HS3ST299560.05trans
rs6942437chr7146798442HS3ST299560.09trans
rs10099022chr824510800HS3ST299560.1trans
rs4242415chr824597175HS3ST299560.03trans
rs16886605chr8115894398HS3ST299563.725E-4trans
rs1494750chr8116094224HS3ST299560.01trans
rs7029518chr937782560HS3ST299560.09trans
rs1020772chr976532511HS3ST299560.07trans
rs11203077chr1091097084HS3ST299560.03trans
rs16933545chr117918293HS3ST299560.19trans
rs10834670chr1125404015HS3ST299560.05trans
rs11019015chr1190157517HS3ST299560.04trans
rs17127472chr11123448587HS3ST299560.16trans
rs12312877chr1279751818HS3ST299560.06trans
rs17627481chr12111777481HS3ST299560.16trans
rs11066476chr12113465366HS3ST299560.03trans
rs11043285chr12122443533HS3ST299560.07trans
rs7971538chr12122473662HS3ST299560.07trans
rs2993290chr13113647189HS3ST299560.02trans
rs13076870HS3ST299560.01trans
rs11158850chr1470757171HS3ST299569.826E-4trans
rs9302779chr163933344HS3ST299560.06trans
rs2369690chr1622920851HS3ST299560.13trans
rs12452652chr1772235560HS3ST299560trans
rs1230712chr1854992531HS3ST299560.04trans
rs862699chr1957863551HS3ST299560.18trans
rs12276chr1958154091HS3ST299560.05trans
rs6119412chr2032470871HS3ST299560.08trans
rs6121844chr2060489981HS3ST299560.06trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
COPE0.910.91
NOSIP0.910.89
EXOSC40.910.91
TIMM17B0.910.92
SCAND10.900.89
FAM96B0.900.89
MRPS340.900.89
ALKBH70.890.91
SF3B50.890.91
DCTN30.880.88
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.15-0.57-0.70
AF347015.26-0.57-0.70
MT-CYB-0.57-0.69
AF347015.27-0.57-0.68
AF347015.8-0.57-0.68
AF347015.33-0.56-0.68
EPB41L2-0.55-0.58
AF347015.2-0.55-0.67
ABCB1-0.54-0.58
MT-CO2-0.53-0.64

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0016740transferase activityIEA-
GO:0008146sulfotransferase activityIEA-
GO:0008146sulfotransferase activityTAS9988767 
GO:0033871[heparan sulfate]-glucosamine 3-sulfotransferase 2 activityIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneIEA-
GO:0005794Golgi apparatusIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneTAS9988767 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG GLYCOSAMINOGLYCAN BIOSYNTHESIS HEPARAN SULFATE 2616All SZGR 2.0 genes in this pathway
REACTOME HS GAG BIOSYNTHESIS 3117All SZGR 2.0 genes in this pathway
REACTOME HEPARAN SULFATE HEPARIN HS GAG METABOLISM 5233All SZGR 2.0 genes in this pathway
REACTOME GLYCOSAMINOGLYCAN METABOLISM 11169All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF CARBOHYDRATES 247154All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN 463290All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D DN 14290All SZGR 2.0 genes in this pathway
SCHLESINGER H3K27ME3 IN NORMAL AND METHYLATED IN CANCER 2821All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS 775494All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN 464276All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 DN 169102All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 3 DN 5932All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP 412249All SZGR 2.0 genes in this pathway
MOREAUX B LYMPHOCYTE MATURATION BY TACI UP 9258All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237837All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER RACE DN 8842All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED 536296All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435318All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103714All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590403All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824528All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-194666672m8hsa-miR-194UGUAACAGCAACUCCAUGUGGA
miR-218651657m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-237307361Ahsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-99/1006706771A,m8hsa-miR-99abrainAACCCGUAGAUCCGAUCUUGUG
hsa-miR-100brainAACCCGUAGAUCCGAACUUGUG
hsa-miR-99bbrainCACCCGUAGAACCGACCUUGCG