SZGR2

Summary ?

GeneID	998
Symbol	CDC42
Synonyms	CDC42Hs\|G25K\|TKS
Description	cell division cycle 42
Reference	MIM:116952\|HGNC:HGNC:1736\|Ensembl:ENSG00000070831\|HPRD:00309\|Vega:OTTHUMG00000002753
Gene type	protein-coding
Map location	1p36.1
Pascal p-value	0.002
Sherlock p-value	0.982
Fetal beta	0.824
eGene	Caudate basal ganglia Myers' cis & trans Meta
Support	STRUCTURAL PLASTICITY

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 3
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 1.1845

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10994209	chr10	61877705	CDC42	998		0.15		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ROBO4	0.84	0.83
MMRN2	0.81	0.83
TIE1	0.81	0.80
CXorf36	0.79	0.81
ENG	0.79	0.82
FLI1	0.77	0.77
GPR124	0.77	0.80
TNFRSF1B	0.76	0.79
FGD5	0.76	0.81
NOS3	0.76	0.78

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MTIF3	-0.51	-0.53
TIMM10	-0.50	-0.51
C8orf59	-0.46	-0.55
TMEM126A	-0.46	-0.51
COX7C	-0.45	-0.50
USMG5	-0.45	-0.58
ST20	-0.45	-0.50
MRPL21	-0.45	-0.48
ZBTB8OS	-0.45	-0.47
MRPS18C	-0.45	-0.50

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003924	GTPase activity	IEA		-
GO:0003924	GTPase activity	TAS		11035016
GO:0005515	protein binding	IPI		10587647 \|10816584 \|11035016
GO:0005525	GTP binding	IEA		-
GO:0030742	GTP-dependent protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0046847	filopodium formation	IEA	axon (GO term level: 10)	-
GO:0007163	establishment or maintenance of cell polarity	TAS		11260256
GO:0007097	nuclear migration	IEA		-
GO:0007264	small GTPase mediated signal transduction	IEA		-
GO:0030036	actin cytoskeleton organization	IDA		11035016
GO:0031333	negative regulation of protein complex assembly	IPI		11584266
GO:0031274	positive regulation of pseudopodium formation	IDA		11035016
GO:0051301	cell division	IEA		-
GO:0030225	macrophage differentiation	TAS		11260256
GO:0043552	positive regulation of phosphoinositide 3-kinase activity	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030175	filopodium	IDA	axon (GO term level: 5)	11035016
GO:0042995	cell projection	IEA	axon (GO term level: 4)	-
GO:0005829	cytosol	EXP		14505571 \|16407834
GO:0005622	intracellular	IEA		-
GO:0005737	cytoplasm	IDA		11260256
GO:0005886	plasma membrane	IDA		11260256

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTR3	ARP3	ARP3 actin-related protein 3 homolog (yeast)	-	HPRD	9860974
ARHGAP1	CDC42GAP \| RHOGAP \| RHOGAP1 \| p50rhoGAP	Rho GTPase activating protein 1	-	HPRD,BioGRID	9268338
ARHGAP1	CDC42GAP \| RHOGAP \| RHOGAP1 \| p50rhoGAP	Rho GTPase activating protein 1	Cdc42GAP interacts with Cdc42. This interaction was modelled on a demonstrated interaction between human Cdc42GAP and Cdc42 from an unspecified species.	BIND	10799524
ARHGAP10	FLJ20896 \| FLJ41791 \| GRAF2 \| PS-GAP	Rho GTPase activating protein 10	Biochemical Activity	BioGRID	11432776
ARHGAP17	DKFZp564A1363 \| FLJ37567 \| FLJ43368 \| MGC87805 \| MST066 \| MST110 \| MSTP038 \| MSTP066 \| MSTP110 \| NADRIN \| RICH1 \| WBP15	Rho GTPase activating protein 17	Biochemical Activity	BioGRID	11431473
ARHGAP26	FLJ42530 \| GRAF \| KIAA0621 \| OPHN1L \| OPHN1L1	Rho GTPase activating protein 26	Biochemical Activity	BioGRID	11432776
ARHGAP27	CAMGAP1 \| FLJ43547 \| MGC120624	Rho GTPase activating protein 27	Biochemical Activity	BioGRID	15147912
ARHGAP29	PARG1 \| RP11-255E17.1	Rho GTPase activating protein 29	Two-hybrid	BioGRID	14749388
ARHGAP8	BPGAP1 \| FLJ20185 \| PP610	Rho GTPase activating protein 8	BPGAP1 interacts with Cdc42.	BIND	12944407
ARHGDIA	GDIA1 \| MGC117248 \| RHOGDI \| RHOGDI-1	Rho GDP dissociation inhibitor (GDI) alpha	-	HPRD	10676816
ARHGDIA	GDIA1 \| MGC117248 \| RHOGDI \| RHOGDI-1	Rho GDP dissociation inhibitor (GDI) alpha	Affinity Capture-MS	BioGRID	17353931
ARHGDIB	D4 \| GDIA2 \| GDID4 \| LYGDI \| Ly-GDI \| RAP1GN1 \| RhoGDI2	Rho GDP dissociation inhibitor (GDI) beta	-	HPRD,BioGRID	9799233
ARHGDIG	RHOGDI-3	Rho GDP dissociation inhibitor (GDI) gamma	-	HPRD,BioGRID	9113980
ARHGEF6	COOL2 \| Cool-2 \| KIAA0006 \| MRX46 \| PIXA \| alpha-PIX \| alphaPIX	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	ARHGEF6 (Cool-2) interacts with Cdc42.	BIND	15649357
ARHGEF7	BETA-PIX \| COOL1 \| DKFZp686C12170 \| DKFZp761K1021 \| KIAA0142 \| KIAA0412 \| Nbla10314 \| P50 \| P50BP \| P85 \| P85COOL1 \| P85SPR \| PAK3 \| PIXB	Rho guanine nucleotide exchange factor (GEF) 7	ARHGEF7 (p85Cool-1) interacts with Cdc42.	BIND	15649357
BAIAP2	BAP2 \| IRSP53	BAI1-associated protein 2	-	HPRD,BioGRID	11696321
BNIP2	BNIP-2 \| NIP2	BCL2/adenovirus E1B 19kDa interacting protein 2	BNIP-2 interacts with an unspecified isoform of Cdc42. This interaction was modeled on a demonstrated interaction between human BNIP-2 and Cdc42 from an unspecified species.	BIND	10954711
BNIP2	BNIP-2 \| NIP2	BCL2/adenovirus E1B 19kDa interacting protein 2	BNIP-2 interacts with an unspecified isoform of Cdc42.	BIND	15652341
BNIP2	BNIP-2 \| NIP2	BCL2/adenovirus E1B 19kDa interacting protein 2	BNIP-2 interacts with Cdc42. This interaction was modelled on a demonstrated interaction between human BNIP-2 and Cdc42 from an unspecified species.	BIND	10799524
BNIP2	BNIP-2 \| NIP2	BCL2/adenovirus E1B 19kDa interacting protein 2	-	HPRD,BioGRID	10551883 \|10799524 \|10954711
BNIPL	BNIP-S \| BNIPL-1 \| BNIPL-2 \| BNIPL1 \| BNIPL2 \| PP753	BCL2/adenovirus E1B 19kD interacting protein like	Affinity Capture-Western Two-hybrid	BioGRID	12901880
C14orf1	ERG28 \| NET51	chromosome 14 open reading frame 1	Two-hybrid	BioGRID	16169070
C1orf103	FLJ11269 \| RIF1 \| RP11-96K19.1	chromosome 1 open reading frame 103	Two-hybrid	BioGRID	16169070
CDC42	CDC42Hs \| G25K	cell division cycle 42 (GTP binding protein, 25kDa)	-	HPRD,BioGRID	10211824
CDC42BPG	DMPK2 \| HSMDPKIN \| KAPPA-200 \| MRCKgamma	CDC42 binding protein kinase gamma (DMPK-like)	-	HPRD,BioGRID	15194684
CDC42EP1	BORG5 \| CEP1 \| MGC15316 \| MSE55	CDC42 effector protein (Rho GTPase binding) 1	Two-hybrid	BioGRID	16189514
CDC42EP2	BORG1 \| CEP2	CDC42 effector protein (Rho GTPase binding) 2	-	HPRD,BioGRID	11035016
CDC42EP2	BORG1 \| CEP2	CDC42 effector protein (Rho GTPase binding) 2	Activated Cdc42 interacts with Borg1. This interaction was modeled on a demonstrated interaction between Cdc42 from an unspecified species and Borg1 from human.	BIND	10490598
CDC42EP3	BORG2 \| CEP3 \| FLJ46903 \| UB1	CDC42 effector protein (Rho GTPase binding) 3	Activated Cdc42 interacts with Borg2. This interaction was modeled on a demonstrated interaction between Cdc42 from an unspecified species and Borg2 from human.	BIND	10490598
CDC42EP3	BORG2 \| CEP3 \| FLJ46903 \| UB1	CDC42 effector protein (Rho GTPase binding) 3	-	HPRD,BioGRID	10490598
CDC42EP5	Borg3 \| CEP5 \| MGC21945 \| MGC71153	CDC42 effector protein (Rho GTPase binding) 5	-	HPRD,BioGRID	10490598 \|11035016 \|11584266\|11035016
CDC42SE1	SCIP1 \| SPEC1	CDC42 small effector 1	-	HPRD,BioGRID	10816584
CDC42SE2	FLJ21967 \| SPEC2	CDC42 small effector 2	Two-hybrid	BioGRID	10816584
CDGAP	KIAA1204 \| MGC138368 \| MGC138370	Cdc42 GTPase-activating protein	-	HPRD	9786927
CLIP1	CLIP \| CLIP-170 \| CLIP170 \| CYLN1 \| MGC131604 \| RSN	CAP-GLY domain containing linker protein 1	Affinity Capture-Western	BioGRID	12110184
CSPG4	HMW-MAA \| MCSP \| MCSPG \| MEL-CSPG \| MSK16 \| NG2	chondroitin sulfate proteoglycan 4	-	HPRD,BioGRID	10587647
DEF6	IBP \| SLAT	differentially expressed in FDCP 6 homolog (mouse)	-	HPRD,BioGRID	15023524
DEF6	IBP \| SLAT	differentially expressed in FDCP 6 homolog (mouse)	DEF6 interacts with Cdc42. This interaction was modelled on a demonstrated interaction between human DEF6 and Cdc42 from an unspecified species.	BIND	15023524
DOCK7	KIAA1771 \| ZIR2	dedicator of cytokinesis 7	-	HPRD	12432077
DOCK8	FLJ00026 \| FLJ00152 \| FLJ00346 \| MRD2 \| ZIR8	dedicator of cytokinesis 8	-	HPRD,BioGRID	15304341
DOCK9	DKFZp686C11110 \| DKFZp686D2047 \| DKFZp686N04132 \| FLJ11949 \| FLJ16744 \| FLJ44528 \| FLJ45282 \| FLJ45601 \| KIAA1058 \| KIAA1085 \| ZIZ1 \| ZIZIMIN1	dedicator of cytokinesis 9	-	HPRD,BioGRID	12172552
EEF1G	EF1G \| GIG35	eukaryotic translation elongation factor 1 gamma	Two-hybrid	BioGRID	16169070
EIF2AK2	EIF2AK1 \| MGC126524 \| PKR \| PRKR	eukaryotic translation initiation factor 2-alpha kinase 2	-	HPRD	7738010
ERRFI1	GENE-33 \| MIG-6 \| MIG6 \| RALT	ERBB receptor feedback inhibitor 1	Affinity Capture-Western Reconstituted Complex	BioGRID	10749885
FGD1	AAS \| FGDY \| ZFYVE3	FYVE, RhoGEF and PH domain containing 1	-	HPRD,BioGRID	8969170
FLNA	ABP-280 \| ABPX \| DKFZp434P031 \| FLN \| FLN1 \| FMD \| MNS \| NHBP \| OPD \| OPD1 \| OPD2	filamin A, alpha (actin binding protein 280)	-	HPRD	10051605
FNBP1L	C1orf39 \| TOCA1	formin binding protein 1-like	Affinity Capture-Western	BioGRID	15260990
GDI1	FLJ41411 \| GDIL \| MRX41 \| MRX48 \| OPHN2 \| RABGD1A \| RABGDIA \| XAP-4	GDP dissociation inhibitor 1	-	HPRD,BioGRID	11583574
GEFT	p63RhoGEF	RhoA/RAC/CDC42 exchange factor	-	HPRD,BioGRID	12547822
GOPC	CAL \| FIG \| GOPC1 \| PIST \| dJ94G16.2	golgi associated PDZ and coiled-coil motif containing	Reconstituted Complex	BioGRID	11162552
IQGAP1	HUMORFA01 \| KIAA0051 \| SAR1 \| p195	IQ motif containing GTPase activating protein 1	-	HPRD	8670801 \|12900413\|8798539 \|9182573
IQGAP1	HUMORFA01 \| KIAA0051 \| SAR1 \| p195	IQ motif containing GTPase activating protein 1	Affinity Capture-Western in vitro in vivo Reconstituted Complex	BioGRID	8670801 \|8798539 \|9182573 \|12110184
IQGAP2	-	IQ motif containing GTPase activating protein 2	-	HPRD	8756646
IQGAP2	-	IQ motif containing GTPase activating protein 2	-	HPRD,BioGRID	8702968 \|8756646\|8756646
ITSN1	ITSN \| MGC134948 \| MGC134949 \| SH3D1A \| SH3P17	intersectin 1 (SH3 domain protein)	Cdc42 specifically interacts with Dbl-homology and pleckstrin-homology domains of the nucleotide exchange factor ITSN1.	BIND	12006984
ITSN1	ITSN \| MGC134948 \| MGC134949 \| SH3D1A \| SH3P17	intersectin 1 (SH3 domain protein)	-	HPRD,BioGRID	11584276
KAT5	ESA1 \| HTATIP \| HTATIP1 \| PLIP \| TIP \| TIP60 \| cPLA2	K(lysine) acetyltransferase 5	Two-hybrid	BioGRID	16169070
KTN1	CG1 \| KIAA0004 \| KNT \| MGC133337 \| MU-RMS-40.19	kinectin 1 (kinesin receptor)	-	HPRD	9535835
MAP3K10	MLK2 \| MST	mitogen-activated protein kinase kinase kinase 10	-	HPRD,BioGRID	9427749
MAP3K11	MGC17114 \| MLK-3 \| MLK3 \| PTK1 \| SPRK	mitogen-activated protein kinase kinase kinase 11	-	HPRD,BioGRID	10799501
MAP3K4	FLJ42439 \| KIAA0213 \| MAPKKK4 \| MEKK4 \| MTK1 \| PRO0412	mitogen-activated protein kinase kinase kinase 4	-	HPRD,BioGRID	9079650
MCF2	DBL	MCF.2 cell line derived transforming sequence	Reconstituted Complex	BioGRID	10854437
MCF2L	ARHGEF14 \| DBS \| FLJ12122 \| KIAA0362 \| OST	MCF.2 cell line derived transforming sequence-like	Cdc42 specifically interacts with Dbl-homology and pleckstrin-homology domains of the nucleotide exchange factor Dbs. This interaction is modelled on a demonstrated interaction between mouse Dbs and human Cdc42.	BIND	11889037
MCF2L	ARHGEF14 \| DBS \| FLJ12122 \| KIAA0362 \| OST	MCF.2 cell line derived transforming sequence-like	-	HPRD,BioGRID	14701795
METAP2	MAP2 \| MNPEP \| p67 \| p67eIF2	methionyl aminopeptidase 2	-	HPRD	7738010
NCF2	FLJ93058 \| NCF-2 \| NOXA2 \| P67-PHOX \| P67PHOX	neutrophil cytosolic factor 2	-	HPRD,BioGRID	7738010 \|9642115\|9642115
NCF2	FLJ93058 \| NCF-2 \| NOXA2 \| P67-PHOX \| P67PHOX	neutrophil cytosolic factor 2	-	HPRD	9642115
OPHN1	MRX60 \| OPN1	oligophrenin 1	-	HPRD,BioGRID	9582072 \|11998687
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	Reconstituted Complex	BioGRID	12650940
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	PAK1 interacts with an unspecified isoform of Cdc42. This interaction was modeled on a demonstrated interaction between PAK1 from an unspecified species and human Cdc42.	BIND	15864311
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	-	HPRD	7744004 \|8107774 \|9705280\|9705280
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	Cdc42 interacts with Pak1. This interaction was modelled on a demonstrated interaction between Cdc42 from an unspecified species and human Pak1.	BIND	12944407
PAK2	PAK65 \| PAKgamma	p21 protein (Cdc42/Rac)-activated kinase 2	-	HPRD,BioGRID	10320322
PAK4	-	p21 protein (Cdc42/Rac)-activated kinase 4	-	HPRD,BioGRID	9822598
PAK6	PAK5	p21 protein (Cdc42/Rac)-activated kinase 6	-	HPRD,BioGRID	11773441
PAK7	KIAA1264 \| MGC26232 \| PAK5	p21 protein (Cdc42/Rac)-activated kinase 7	-	HPRD,BioGRID	11756552 \|12032833
PARD3	ASIP \| Baz \| Bazooka \| FLJ21015 \| PAR3 \| PAR3alpha \| PARD3A \| SE2-5L16 \| SE2-5LT1 \| SE2-5T2	par-3 partitioning defective 3 homolog (C. elegans)	-	HPRD	10934474
PARD6A	PAR-6A \| PAR6 \| PAR6C \| PAR6alpha \| TAX40 \| TIP-40	par-6 partitioning defective 6 homolog alpha (C. elegans)	Affinity Capture-Western in vitro in vivo Reconstituted Complex Two-hybrid	BioGRID	10873802 \|10934474 \|11260256
PARD6A	PAR-6A \| PAR6 \| PAR6C \| PAR6alpha \| TAX40 \| TIP-40	par-6 partitioning defective 6 homolog alpha (C. elegans)	-	HPRD	10873802\|11260256
PARD6B	PAR6B	par-6 partitioning defective 6 homolog beta (C. elegans)	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	10934474 \|11162552
PARD6G	FLJ45701 \| PAR-6G \| PAR6gamma	par-6 partitioning defective 6 homolog gamma (C. elegans)	-	HPRD,BioGRID	11260256
PDE6D	PDED	phosphodiesterase 6D, cGMP-specific, rod, delta	Two-hybrid	BioGRID	16169070
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	-	HPRD,BioGRID	7629060 \|8034624 \|9381982
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	-	HPRD	9381982
PLD1	-	phospholipase D1, phosphatidylcholine-specific	-	HPRD,BioGRID	10747870
PLEKHG2	CLG \| DKFZp667J2325 \| FLJ00018 \| FLJ22458 \| FLJ38638	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	-	HPRD,BioGRID	11839748
PRKCA	AAG6 \| MGC129900 \| MGC129901 \| PKC-alpha \| PKCA \| PRKACA	protein kinase C, alpha	-	HPRD,BioGRID	11284700
PRKCZ	PKC-ZETA \| PKC2	protein kinase C, zeta	-	HPRD	10733591
RAC1	MGC111543 \| MIG5 \| TC-25 \| p21-Rac1	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	Two-hybrid	BioGRID	9427749
RAC2	EN-7 \| Gx \| HSPC022	ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)	-	HPRD,BioGRID	9748241
RHOJ	ARHJ \| FLJ14445 \| MGC34777 \| RASL7B \| TC10B \| TCL	ras homolog gene family, member J	-	HPRD,BioGRID	10967094
RICH2	KIAA0672 \| NPC-A-10	Rho-type GTPase-activating protein RICH2	Biochemical Activity	BioGRID	11431473
RICS	GC-GAP \| GRIT \| KIAA0712 \| MGC1892 \| p200RhoGAP \| p250GAP	Rho GTPase-activating protein	Biochemical Activity	BioGRID	12446789 \|12819203 \|12857875
RPS6KB1	PS6K \| S6K \| S6K1 \| STK14A \| p70(S6K)-alpha \| p70-S6K \| p70-alpha	ribosomal protein S6 kinase, 70kDa, polypeptide 1	-	HPRD	11438723
SRGAP1	ARHGAP13 \| FLJ22166 \| KIAA1304	SLIT-ROBO Rho GTPase activating protein 1	-	HPRD	11672528
TBC1D3	TBC1D3A \| TRE17	TBC1 domain family, member 3	-	HPRD,BioGRID	12612085
TNK2	ACK \| ACK1 \| FLJ44758 \| FLJ45547 \| p21cdc42Hs	tyrosine kinase, non-receptor, 2	-	HPRD,BioGRID	11394904
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Two-hybrid	BioGRID	16169070
TRIP10	CIP4 \| HSTP \| STOT \| STP	thyroid hormone receptor interactor 10	-	HPRD,BioGRID	9210375 \|10713100
UBR1	JBS \| MGC142065 \| MGC142067	ubiquitin protein ligase E3 component n-recognin 1	Two-hybrid	BioGRID	16169070
UNC119	HRG4	unc-119 homolog (C. elegans)	Two-hybrid	BioGRID	16169070
VAV1	VAV	vav 1 guanine nucleotide exchange factor	-	HPRD,BioGRID	11287617
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	CDC42 interacts with WASP. This interaction was modeled on a demonstrated interaction between CDC42 and WASP from an unspecified species.	BIND	15652748
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	Active GTP-bound CDC42 interacts with WAS (WASP). This interaction was modelled on a demonstrated interaction between chicken CDC42 and human WAS.	BIND	15735674
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	Cdc42 interacts with WASP.	BIND	15361624
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	-	HPRD	8625410 \|10724160
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	in vitro in vivo Reconstituted Complex	BioGRID	8625410 \|8643625 \|10713100 \|10724160
WASF1	FLJ31482 \| KIAA0269 \| SCAR1 \| WAVE \| WAVE1	WAS protein family, member 1	-	HPRD	12181570
WASF2	SCAR2 \| WAVE2 \| dJ393P12.2	WAS protein family, member 2	-	HPRD	12181570
WASL	DKFZp779G0847 \| MGC48327 \| N-WASP \| NWASP	Wiskott-Aldrich syndrome-like	in vitro Reconstituted Complex	BioGRID	9422512 \|10781580
WASL	DKFZp779G0847 \| MGC48327 \| N-WASP \| NWASP	Wiskott-Aldrich syndrome-like	-	HPRD	9422512 \|10724160

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
KEGG VEGF SIGNALING PATHWAY	76	53	All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG ADHERENS JUNCTION	75	53	All SZGR 2.0 genes in this pathway
KEGG TIGHT JUNCTION	134	86	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS	97	71	All SZGR 2.0 genes in this pathway
KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION	118	78	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG REGULATION OF ACTIN CYTOSKELETON	216	144	All SZGR 2.0 genes in this pathway
KEGG GNRH SIGNALING PATHWAY	101	77	All SZGR 2.0 genes in this pathway
KEGG EPITHELIAL CELL SIGNALING IN HELICOBACTER PYLORI INFECTION	68	44	All SZGR 2.0 genes in this pathway
KEGG PATHOGENIC ESCHERICHIA COLI INFECTION	59	36	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG RENAL CELL CARCINOMA	70	60	All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER	70	56	All SZGR 2.0 genes in this pathway
BIOCARTA AGR PATHWAY	36	31	All SZGR 2.0 genes in this pathway
BIOCARTA SALMONELLA PATHWAY	13	10	All SZGR 2.0 genes in this pathway
BIOCARTA P38MAPK PATHWAY	40	31	All SZGR 2.0 genes in this pathway
BIOCARTA RAS PATHWAY	23	20	All SZGR 2.0 genes in this pathway
BIOCARTA MAL PATHWAY	19	17	All SZGR 2.0 genes in this pathway
BIOCARTA CDC42RAC PATHWAY	16	13	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
SIG CHEMOTAXIS	45	37	All SZGR 2.0 genes in this pathway
ST P38 MAPK PATHWAY	37	28	All SZGR 2.0 genes in this pathway
SIG REGULATION OF THE ACTIN CYTOSKELETON BY RHO GTPASES	35	25	All SZGR 2.0 genes in this pathway
ST INTEGRIN SIGNALING PATHWAY	82	62	All SZGR 2.0 genes in this pathway
ST GA13 PATHWAY	37	32	All SZGR 2.0 genes in this pathway
SIG INSULIN RECEPTOR PATHWAY IN CARDIAC MYOCYTES	51	41	All SZGR 2.0 genes in this pathway
ST JNK MAPK PATHWAY	40	30	All SZGR 2.0 genes in this pathway
PID ENDOTHELIN PATHWAY	63	52	All SZGR 2.0 genes in this pathway
PID RHOA PATHWAY	45	33	All SZGR 2.0 genes in this pathway
PID WNT NONCANONICAL PATHWAY	32	26	All SZGR 2.0 genes in this pathway
PID TCR PATHWAY	66	51	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID EPHB FWD PATHWAY	40	38	All SZGR 2.0 genes in this pathway
PID AVB3 OPN PATHWAY	31	29	All SZGR 2.0 genes in this pathway
PID S1P S1P4 PATHWAY	14	11	All SZGR 2.0 genes in this pathway
PID ILK PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID NECTIN PATHWAY	30	20	All SZGR 2.0 genes in this pathway
PID P38 ALPHA BETA PATHWAY	31	25	All SZGR 2.0 genes in this pathway
PID CDC42 PATHWAY	70	51	All SZGR 2.0 genes in this pathway
PID CDC42 REG PATHWAY	30	22	All SZGR 2.0 genes in this pathway
PID NETRIN PATHWAY	32	27	All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY	102	78	All SZGR 2.0 genes in this pathway
PID AJDISS 2PATHWAY	48	38	All SZGR 2.0 genes in this pathway
PID ECADHERIN NASCENT AJ PATHWAY	39	33	All SZGR 2.0 genes in this pathway
PID LIS1 PATHWAY	28	22	All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY	105	78	All SZGR 2.0 genes in this pathway
PID ERBB2 ERBB3 PATHWAY	44	35	All SZGR 2.0 genes in this pathway
PID TRKR PATHWAY	62	48	All SZGR 2.0 genes in this pathway
PID AR NONGENOMIC PATHWAY	31	27	All SZGR 2.0 genes in this pathway
PID ERBB1 INTERNALIZATION PATHWAY	41	35	All SZGR 2.0 genes in this pathway
PID VEGFR1 2 PATHWAY	69	57	All SZGR 2.0 genes in this pathway
PID NCADHERIN PATHWAY	33	32	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY RHO GTPASES	113	81	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY EGFR IN CANCER	109	80	All SZGR 2.0 genes in this pathway
REACTOME EGFR DOWNREGULATION	25	14	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME GPVI MEDIATED ACTIVATION CASCADE	31	25	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME G ALPHA1213 SIGNALLING EVENTS	74	56	All SZGR 2.0 genes in this pathway
REACTOME CD28 CO STIMULATION	32	26	All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING	805	368	All SZGR 2.0 genes in this pathway
REACTOME CD28 DEPENDENT VAV1 PATHWAY	11	10	All SZGR 2.0 genes in this pathway
REACTOME SEMA4D IN SEMAPHORIN SIGNALING	32	22	All SZGR 2.0 genes in this pathway
REACTOME SEMAPHORIN INTERACTIONS	68	53	All SZGR 2.0 genes in this pathway
REACTOME SEMA4D INDUCED CELL MIGRATION AND GROWTH CONE COLLAPSE	27	21	All SZGR 2.0 genes in this pathway
REACTOME COSTIMULATION BY THE CD28 FAMILY	63	48	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ROBO RECEPTOR	30	26	All SZGR 2.0 genes in this pathway
REACTOME MYOGENESIS	28	20	All SZGR 2.0 genes in this pathway
REACTOME NETRIN1 SIGNALING	41	30	All SZGR 2.0 genes in this pathway
REACTOME DCC MEDIATED ATTRACTIVE SIGNALING	13	11	All SZGR 2.0 genes in this pathway
REACTOME FACTORS INVOLVED IN MEGAKARYOCYTE DEVELOPMENT AND PLATELET PRODUCTION	132	101	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ADAPTIVE IMMUNE SYSTEM	539	350	All SZGR 2.0 genes in this pathway
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION	208	138	All SZGR 2.0 genes in this pathway
WATANABE COLON CANCER MSI VS MSS DN	81	42	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN	493	298	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP	473	314	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN	320	184	All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN DN	241	146	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN	352	225	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP	78	48	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN	205	127	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN	260	143	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP	557	331	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES CD4 DN	116	71	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES DN	16	10	All SZGR 2.0 genes in this pathway
COLDREN GEFITINIB RESISTANCE DN	230	115	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR DN	64	39	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR DN	75	50	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
LI LUNG CANCER	41	30	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC 24HR 3 DN	13	8	All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC 24HR 5 DN	59	35	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
SAKAI TUMOR INFILTRATING MONOCYTES DN	81	51	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP	266	171	All SZGR 2.0 genes in this pathway
IGLESIAS E2F TARGETS UP	151	103	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP	240	152	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR	544	307	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN	371	218	All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C4	18	12	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL	311	205	All SZGR 2.0 genes in this pathway
LEE AGING MUSCLE UP	45	33	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN	270	181	All SZGR 2.0 genes in this pathway
OUYANG PROSTATE CANCER PROGRESSION UP	20	14	All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1	91	75	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS UP	374	247	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
HAHTOLA CTCL CUTANEOUS	26	19	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE M G1	148	95	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA NEURAL	129	85	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT	572	352	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
IKEDA MIR133 TARGETS UP	43	27	All SZGR 2.0 genes in this pathway
KRIEG KDM3A TARGETS NOT HYPOXIA	208	107	All SZGR 2.0 genes in this pathway
LIU IL13 MEMORY MODEL UP	17	12	All SZGR 2.0 genes in this pathway
ABDELMOHSEN ELAVL4 TARGETS	16	13	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR UP	166	97	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	534	541	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-128	744	750	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	744	750	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-133	1117	1123	m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	1117	1123	m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-137	50	56	m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-141/200a	1237	1243	1A	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	1237	1243	1A	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-18	837	843	m8	hsa-miR-18a	UAAGGUGCAUCUAGUGCAGAUA
miR-18	837	843	m8	hsa-miR-18b	UAAGGUGCAUCUAGUGCAGUUA
miR-185	647	654	1A,m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-186	1389	1395	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-224	747	753	m8	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-25/32/92/363/367	97	103	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-27	744	750	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	744	750	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-29	578	584	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-299-3p	125	131	m8	hsa-miR-299-3p	UAUGUGGGAUGGUAAACCGCUU
miR-342	138	145	1A,m8	hsa-miR-342^brain	UCUCACACAGAAAUCGCACCCGUC
miR-381	1379	1385	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CDC42