Gene Page: SLC12A6
Summary ?
GeneID | 9990 |
Symbol | SLC12A6 |
Synonyms | ACCPN|KCC3|KCC3A|KCC3B |
Description | solute carrier family 12 member 6 |
Reference | MIM:604878|HGNC:HGNC:10914|Ensembl:ENSG00000140199|HPRD:09220|Vega:OTTHUMG00000129441 |
Gene type | protein-coding |
Map location | 15q13 |
Pascal p-value | 0.115 |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DCUN1D1 | 0.87 | 0.85 |
STX12 | 0.86 | 0.85 |
CHMP2B | 0.85 | 0.85 |
ACSL4 | 0.84 | 0.86 |
OTUD6B | 0.84 | 0.84 |
ATAD1 | 0.83 | 0.84 |
RAB18 | 0.83 | 0.83 |
TRNT1 | 0.83 | 0.84 |
RAB23 | 0.83 | 0.83 |
RAB2A | 0.83 | 0.83 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FXYD1 | -0.58 | -0.55 |
EIF4EBP3 | -0.57 | -0.60 |
MT-CO2 | -0.56 | -0.55 |
PTPRCAP | -0.56 | -0.58 |
AC018755.7 | -0.55 | -0.58 |
AF347015.21 | -0.53 | -0.45 |
HSD17B14 | -0.53 | -0.53 |
HIGD1B | -0.53 | -0.54 |
METRN | -0.52 | -0.58 |
AF347015.31 | -0.52 | -0.53 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
GO:0005215 | transporter activity | IEA | - | |
GO:0015377 | cation:chloride symporter activity | IEA | - | |
GO:0015379 | potassium:chloride symporter activity | NAS | - | |
GO:0015293 | symporter activity | IEA | - | |
GO:0030955 | potassium ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008217 | regulation of blood pressure | NAS | - | |
GO:0006821 | chloride transport | IEA | - | |
GO:0006814 | sodium ion transport | IEA | - | |
GO:0006811 | ion transport | IEA | - | |
GO:0006813 | potassium ion transport | IEA | - | |
GO:0006884 | cell volume homeostasis | NAS | - | |
GO:0006873 | cellular ion homeostasis | IC | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
GO:0005624 | membrane fraction | TAS | 10187864 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 10187864 | |
GO:0016323 | basolateral plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
REACTOME SLC MEDIATED TRANSMEMBRANE TRANSPORT | 241 | 157 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSPORT OF INORGANIC CATIONS ANIONS AND AMINO ACIDS OLIGOPEPTIDES | 94 | 65 | All SZGR 2.0 genes in this pathway |
PARENT MTOR SIGNALING DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS C UP | 170 | 114 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED MODERATELY VS POORLY UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
LIN SILENCED BY TUMOR MICROENVIRONMENT | 108 | 73 | All SZGR 2.0 genes in this pathway |
PEART HDAC PROLIFERATION CLUSTER UP | 57 | 35 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS REQUIRE MYC | 210 | 123 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K27ME3 UP | 295 | 149 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP | 259 | 159 | All SZGR 2.0 genes in this pathway |
BAKKER FOXO3 TARGETS UP | 61 | 41 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
PEDERSEN TARGETS OF 611CTF ISOFORM OF ERBB2 | 76 | 45 | All SZGR 2.0 genes in this pathway |
HUANG GATA2 TARGETS UP | 149 | 96 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-135 | 1195 | 1202 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-137 | 3182 | 3189 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-151 | 3101 | 3107 | 1A | hsa-miR-151brain | ACUAGACUGAAGCUCCUUGAGG |
miR-18 | 3208 | 3215 | 1A,m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
miR-24 | 136 | 142 | m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-30-3p | 3189 | 3196 | 1A,m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-30-5p | 3808 | 3815 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-96 | 1080 | 1086 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.