| Basic Information ▶ | |
| VISDB ID | TVIS10000362 |
|---|---|
| Fusion Name | HBV-FAM90A11P integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | invPCR+NAH |
| Wet Assay | Yes |
| Sample ID | NL01.A |
| Sample Name | NL01.A |
| Sample Type | Cell line |
| Age | 58 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 28414318 |
| Journal | Oncogenesis |
| Published Year | 2017 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr8 |
| Cytogenetic Band | p23.1 |
| Human Strand | |
| Human Integration Location Type | Intronic |
| Hg19 Start | 7874512 |
| Hg19 End | 7874653 |
| Hg38 Start | 8016990 |
| Hg38 End | 8017131 |
| Junction Sequence | GGACCCAGGGAATTAGAGCCTCACAGGCGTCCGGGAGACTTTTCAGGCATAATGCCTGGAGTCGCAAGACGAGCTGAAAAAGGAGCCAGGCACTGAAGGACAAAGCGTTGTTGACTTTCCTCATCTGTGTTTCCCAGTGCG |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | FAM90A11 |
| Distance | 1639 |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | A |
| Virus Genome Accession | X70185.1 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B Virus X, C, P and S overlapping ORF's |
| Virus Genome Length | 3221 |
| Virus Breakpoint1 | 1603 |
| Virus Breakpoint2 | 1623 |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | TTGCATGGAGACCACCGTGAA |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D