| Basic Information ▶ | |
| VISDB ID | TVIS10000364 |
|---|---|
| Fusion Name | HBV-ZNF782 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | invPCR+NAH |
| Wet Assay | Yes |
| Sample ID | NL01.A |
| Sample Name | NL01.A |
| Sample Type | Cell line |
| Age | 58 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 28414318 |
| Journal | Oncogenesis |
| Published Year | 2017 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr9 |
| Cytogenetic Band | q22.33 |
| Human Strand | |
| Human Integration Location Type | Intronic |
| Hg19 Start | 99607513 |
| Hg19 End | 99607557 |
| Hg38 Start | 96845231 |
| Hg38 End | 96845275 |
| Junction Sequence | CACATACATTGTTACTTAATATACTGAGGAAGCTTAGTACCCTT |
| Target Gene ▶ | |
| Target Gene | ZNF782 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | A |
| Virus Genome Accession | X70185.1 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B Virus X, C, P and S overlapping ORF's |
| Virus Genome Length | 3221 |
| Virus Breakpoint1 | 1638 |
| Virus Breakpoint2 | 1784 |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | TGCCCAAGGTCTTACATAAGAGGACTCTTGGACTCTCAGCAATGTCAACGACCGACCTTGAGGCCTACTTCAAAGACTGTGTGTTTAAGGACTGGGAGGAGCTGGGGGAGGAGATTAGGTTAAAGGTCTTTGTATTAGGAGGCTGTA |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000196597.14 |
| Gene Name | ZNF782 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000893217.1, Transcript 2: ENST00000481138.6, Transcript 3: ENST00000917517.1, Transcript 4: ENST00000893219.1, Transcript 5: ENST00000893218.1, Transcript 6: ENST00000535338.5, Transcript 7: ENST00000289032.12, Transcript 8: ENST00000466833.5, Transcript 9: ENST00000478850.5, Transcript 10: ENST00000498811.2 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.010 | Acceptor Loss: 0.040 | Donor Gain: 0.010 | Donor Loss: 0.000 |
| Delta Score Max | 0.040 |
| Delta Position at Max | -215 |
| Delta Score Flag | LOW |
| Gene | ZNF782 |
| AlphaGenome Analysis | |
| Window | chr9:96779695-96910767 |
| RNA-seq Change (±2kb) | Mean: 0.0007719964487478137 | Peak: 0.09375 |
| ATAC Change (±2kb) | Mean: 0.0002767913101706654 | Peak: 1.2578125 |
| Interpretation | RNA-seq: minimal change 4.1% | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 1.9% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D