| Basic Information ▶ | |
| VISDB ID | TVIS10000367 |
|---|---|
| Fusion Name | HBV-ANK3 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | invPCR+NAH |
| Wet Assay | Yes |
| Sample ID | NL01.A |
| Sample Name | NL01.A |
| Sample Type | Cell line |
| Age | 58 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 28414318 |
| Journal | Oncogenesis |
| Published Year | 2017 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr10 |
| Cytogenetic Band | q21.2 |
| Human Strand | |
| Human Integration Location Type | Intronic |
| Hg19 Start | 111339527 |
| Hg19 End | 111339567 |
| Hg38 Start | 109579769 |
| Hg38 End | 109579809 |
| Junction Sequence | CAAAGACTGTTTACTTATAACTCTGTTGTCCCTGTTGTCC |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | A |
| Virus Genome Accession | X70185.1 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B Virus X, C, P and S overlapping ORF's |
| Virus Genome Length | 3221 |
| Virus Breakpoint1 | 1647 |
| Virus Breakpoint2 | 1720 |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | TCTTACATAAGAGGACTCTTGGACTCTCAGCAATGTCAACGACCGACCTTGAGGCCTACTTCAAAGACTGTGTG |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D