| Basic Information ▶ | |
| VISDB ID | TVIS10000436 |
|---|---|
| Fusion Name | AAV2-CCNA2 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | PCR and Sanger sequencing |
| Wet Assay | Yes |
| Sample ID | CHC2112T |
| Sample Name | CHC2112T |
| Sample Type | Tumor |
| Age | 48 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 26301494 |
| Journal | Nature GeNetics |
| Published Year | 2015 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr4 |
| Cytogenetic Band | q27 |
| Human Strand | + |
| Human Integration Location Type | Intronic |
| Hg19 Start | 122742660 |
| Hg19 End | 122742667 |
| Hg38 Start | 121821505 |
| Hg38 End | 121821512 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | CCNA2 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Adeno-associated virus type 2 |
| Virus Subtype Name | - |
| Virus Genome Accession | AF043303.1 |
| TaxonomyID | 272636 |
| Virus Abbreviation | AAV2 |
| Virus Genome | Adeno-associated virus 2, complete genome |
| Virus Genome Length | 4679 |
| Virus Breakpoint1 | 4604 |
| Virus Breakpoint2 | 4389 |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | TACCTGACTCGTAATCTGTAATTGCTTGTTAATCAATAAACCGTTTAATTCGTTTCAGTTGAACTTTGGTCTCTGCGTATTTCTTTCTTATCTAGTTTCCATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCA |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D