| Basic Information ▶ | |
| VISDB ID | TVIS10000439 |
|---|---|
| Fusion Name | AAV2-TNFSF10 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | PCR and Sanger sequencing |
| Wet Assay | Yes |
| Sample ID | CHC2557T |
| Sample Name | CHC2557T |
| Sample Type | Tumor |
| Age | 70 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 26301494 |
| Journal | Nature GeNetics |
| Published Year | 2015 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr3 |
| Cytogenetic Band | q26.31 |
| Human Strand | + |
| Human Integration Location Type | Intronic |
| Hg19 Start | 172224150 |
| Hg19 End | 172584400 |
| Hg38 Start | 172506360 |
| Hg38 End | 172866610 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | TBPL1P1, ENSG00000296986, SLC31A1P1, ENSG00000299961, NAP1L5P1, RNU6-547P, SNORA72, RNU4-4P, ATP5MC1P4, MMACHCP1, TNFSF10, LINC02068, NCEH1, ENSG00000287012, ENSG00000300898, ECT2 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Adeno-associated virus type 2 |
| Virus Subtype Name | - |
| Virus Genome Accession | AF043303.1 |
| TaxonomyID | 272636 |
| Virus Abbreviation | AAV2 |
| Virus Genome | Adeno-associated virus 2, complete genome |
| Virus Genome Length | 4679 |
| Virus Breakpoint1 | 4388 |
| Virus Breakpoint2 | 4597 |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | ATACCTGACTCGTAATCTGTAATTGCTTGTTAATCAATAAACCGTTTAATTCGTTTCAGTTGAACTTTGGTCTCTGCGTATTTCTTTCTTATCTAGTTTCCATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGG |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D