Basic Information ▶ | |
VISDB ID | TVIS10006394 |
---|---|
Fusion Name | HBV-KRTAP7-1 integration |
Validated | Yes |
Curated Way | VISDB1.0 |
Method | Inverse nested PCR (invPCR) and sequencing |
Wet Assay | Yes |
Sample ID | 4 |
Sample Name | 4 |
Sample Type | Tumor |
Age | 18 |
Gender | - |
Disease Information ▶ | |
Disease Name | Hepatocellular carcinoma |
Disease Abbreviation | HCC |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 27453547 |
Journal | Gastroenterology |
Published Year | 2016 |
Human Genome ▶ | |
Human Genome Version Description | GRCh38 |
Human Genome RefSeq Accession | GCF_000001405.38 |
Human Chromosome | chr21 |
Cytogenetic Band | q22.11 |
Human Strand | |
Human Integration Location Type | at beginning of exon |
Hg19 Start | 30829731 |
Hg19 End | 30829731 |
Hg38 Start | 30829731 |
Hg38 End | 30829731 |
Junction Sequence | - |
Target Gene ▶ | |
Target Gene | KRTAP7-1 |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Hepatitis B virus |
Virus Subtype Name | - |
Virus Genome Accession | V01460.1 |
TaxonomyID | 10407 |
Virus Abbreviation | HBV |
Virus Genome | Hepatitis B virus (strain ayw) genome |
Virus Genome Length | 3182 |
Virus Breakpoint1 | 1726 |
Virus Breakpoint2 | - |
Virus Gene Name | - |
Virus Region Type | - |
Integrated Virus Sequence | GCACAGACGGGGAGTCCGCGTAAAGAGAGGTGCGCCCCGTGGTCGGTCGGAACGGCAGACGGAGAAGGGGACGAGAGAGTCCCAAGCGACCCCGAGAAGG| |GTCGTCCGCAGGATTCAGCGCCGACGGGACGTAAACAAAGGACGTCCCGCGCAGGATCCAGTTGGCAGCACAGCCTAGCAGCCATGGAAACGATGTATAT |
ViMIC ID | - |