| Basic Information ▶ | |
| VISDB ID | TVIS10006468 |
|---|---|
| Fusion Name | HBV-ALB integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Inverse nested PCR (invPCR) and sequencing |
| Wet Assay | Yes |
| Sample ID | 7 |
| Sample Name | 7 |
| Sample Type | Tumor |
| Age | 28 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 27453547 |
| Journal | Gastroenterology |
| Published Year | 2016 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38 |
| Human Genome RefSeq Accession | GCF_000001405.38 |
| Human Chromosome | chr4 |
| Cytogenetic Band | q13.3 |
| Human Strand | |
| Human Integration Location Type | Intron |
| Hg19 Start | 73404654 |
| Hg19 End | 73404654 |
| Hg38 Start | 73404654 |
| Hg38 End | 73404654 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | ALB |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | - |
| Virus Genome Accession | V01460.1 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus (strain ayw) genome |
| Virus Genome Length | 3182 |
| Virus Breakpoint1 | 3177 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | AGGCAGTAGTCAGAACAGGGTTTACTGTTCCTGAACTGGAGCCACCAGCAGGGAAATACAGGCCTCTCACTCTGGGATCTTGCAGAGTTTGGTGGAAGGT| |TGTGG |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D