| Basic Information ▶ | |
| VISDB ID | TVIS10006823 |
|---|---|
| Fusion Name | HBV-chr20:p12.3 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Alu PCR and sequencing |
| Wet Assay | Yes |
| Sample ID | 6 |
| Sample Name | 6 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 25815780 |
| Journal | Epigenomics |
| Published Year | 2015 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.38 |
| Human Chromosome | chr20 |
| Cytogenetic Band | p12.3 |
| Human Strand | - |
| Human Integration Location Type | - |
| Hg19 Start | 5639689 |
| Hg19 End | 5640156 |
| Hg38 Start | 5639689 |
| Hg38 End | 5640156 |
| Junction Sequence | ctgcactccagcctgggcaccattgagcactgagtgaacgagactccgtctgcaatcccggcacctcgggaggccgaggctggcggatcactcgcggtcaggagctggagaccagcccggccaacacagggaaaccctgtctccaccaaaacaatacgaaaaccagtcaggcgtggcggcgcgcgcctgcaatcgcaggcactcggcaggctgaggcaggagaatcaggcagggaggttgcagtgagcagagatg |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | ENSG00000305410 |
| Distance | 5533 |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | - |
| Virus Genome Accession | Not given |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | - |
| Virus Genome Length | 0 |
| Virus Breakpoint1 | 2224 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D