| Basic Information ▶ | |
| VISDB ID | TVIS10006871 |
|---|---|
| Fusion Name | HBV-chr8 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Alu PCR and sequencing |
| Wet Assay | Yes |
| Sample ID | L-16T |
| Sample Name | L-16T |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 25627239 |
| Journal | HEPATOLOGY |
| Published Year | 2015 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr8 |
| Cytogenetic Band | q24.21 |
| Human Strand | |
| Human Integration Location Type | Intergenic |
| Hg19 Start | 128764911 |
| Hg19 End | 128764911 |
| Hg38 Start | 127752665 |
| Hg38 End | 127752665 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | ENSG00000308490 |
| Distance | 1878 |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | B2 |
| Virus Genome Accession | JQ688405 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus isolate HBVB2, complete genome |
| Virus Genome Length | 3215 |
| Virus Breakpoint1 | 660 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | Polymerase,S protein |
| Integrated Virus Sequence | CATGTTGCTGTACAAAACCTACGGACGGAAACTGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCG| |TTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTCTGGCTTTCAGTTATATGGATGATGTGGTTTTGGGGG |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D