| Basic Information ▶ | |
| VISDB ID | TVIS10007603 | 
|---|---|
| Fusion Name | HBV-chr2 integration | 
| Validated | No | 
| Curated Way | VISDB1.0 | 
| Method | Next generation sequencing | 
| Wet Assay | No | 
| Sample ID | 81222 | 
| Sample Name | 081222T | 
| Sample Type | Tumor | 
| Age | - | 
| Gender | - | 
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma | 
| Disease Abbreviation | HCC | 
| Cancer | Yes | 
| Literature ▶ | |
| PubMed ID | 30271481 | 
| Journal | Journal of Cancer | 
| Published Year | 2018 | 
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 | 
| Human Genome RefSeq Accession | GCF_000001405.13 | 
| Human Chromosome | chr2 | 
| Cytogenetic Band | p11.2 | 
| Human Strand | + | 
| Human Integration Location Type | Intergenic | 
| Hg19 Start | 87998719 | 
| Hg19 End | 87998719 | 
| Hg38 Start | 87699200 | 
| Hg38 End | 87699200 | 
| Junction Sequence | - | 
| Target Gene ▶ | |
| Target Gene | NCAL1 | 
| Nearby Gene | - | 
| Distance | - | 
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus | 
| Virus Subtype Name | - | 
| Virus Genome Accession | NC_003977 | 
| TaxonomyID | 10407 | 
| Virus Abbreviation | HBV | 
| Virus Genome | Hepatitis B virus (strain ayw) genome | 
| Virus Genome Length | 3182 | 
| Virus Breakpoint1 | 1958 | 
| Virus Breakpoint2 | - | 
| Virus Gene Name | - | 
| Virus Region Type | precore/core protein|Core and e antigen| | 
| Integrated Virus Sequence | CTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATCGACCCTTATAAAGAATTTGGAGCTACTGTGGAGTTACTCTCGTTTTT| |GCCTTCTGACTTCTTTCCTTCAGTACGAGATCTTCTAGATACCGCCTCAGCTCTGTATCGGGAAGCCTTAGAGTCTCCTGAGCATTGTTCACCTCACCAT | 
| ViMIC ID | - |