Basic Information ▶ | |
VISDB ID | TVIS10012545 |
---|---|
Fusion Name | HBV-CACNB2 integration |
Validated | No |
Curated Way | VISDB1.0 |
Method | Next generation sequencing |
Wet Assay | No |
Sample ID | 807 |
Sample Name | 807P |
Sample Type | Nontumor |
Age | - |
Gender | - |
Disease Information ▶ | |
Disease Name | Hepatocellular carcinoma |
Disease Abbreviation | HCC |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 30271481 |
Journal | Journal of Cancer |
Published Year | 2018 |
Human Genome ▶ | |
Human Genome Version Description | GRCh37/hg19 |
Human Genome RefSeq Accession | GCF_000001405.13 |
Human Chromosome | chr10 |
Cytogenetic Band | p12.33 |
Human Strand | + |
Human Integration Location Type | Intronic |
Hg19 Start | 18474249 |
Hg19 End | 18474249 |
Hg38 Start | 18185320 |
Hg38 End | 18185320 |
Junction Sequence | - |
Target Gene ▶ | |
Target Gene | CACNB2 |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Hepatitis B virus |
Virus Subtype Name | - |
Virus Genome Accession | NC_003977 |
TaxonomyID | 10407 |
Virus Abbreviation | HBV |
Virus Genome | Hepatitis B virus (strain ayw) genome |
Virus Genome Length | 3182 |
Virus Breakpoint1 | 2419 |
Virus Breakpoint2 | - |
Virus Gene Name | - |
Virus Region Type | precore/core protein|Core and e antigen|Polymerase| |
Integrated Virus Sequence | CTATCAACACTTCCGGAGACTACTGTTGTTAGACGACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCGTC| |GCAGAAGATCTCAATCTCGGGAATCTCAATGTTAGTATTCCTTGGACTCATAAGGTGGGGAACTTTACTGGGCTTTATTCTTCTACTGTACCTGTCTTTA |
ViMIC ID | - |