| Basic Information ▶ | |
| VISDB ID | TVIS10014883 |
|---|---|
| Fusion Name | HBV-UPF3A integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | PCR and Sanger sequencing |
| Wet Assay | Yes |
| Sample ID | HKCI-4 |
| Sample Name | HKCI-4 |
| Sample Type | Cell line |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 24582836 |
| Journal | Cancer Cell |
| Published Year | 2014 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37.p10 |
| Human Genome RefSeq Accession | GCF_000001405.22 |
| Human Chromosome | chr13 |
| Cytogenetic Band | q34 |
| Human Strand | + |
| Human Integration Location Type | Intronic |
| Hg19 Start | 115070262 |
| Hg19 End | 115070459 |
| Hg38 Start | 114304787 |
| Hg38 End | 114304984 |
| Junction Sequence | GGACCGGCCAGCCTTGCAGCTGTATGATCCAGGAGCTCGCTTCCGAGCGCGAGAGTGTGGCGGAAACAGGAGGATCTGCAAGGCAGAAGGTTCGGGGACTGGTCCTGAGAAGAGGGAAGAGGCAGAGTGAGTCACTGCACGCACCTGGCCTCCATGGACGAGCAAGGGCATCCCAGAAACGTGTAAATGACCCCGAG |
| Target Gene ▶ | |
| Target Gene | UPF3A |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | - |
| Virus Genome Accession | NC_003977.1 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus, complete genome |
| Virus Genome Length | 3215 |
| Virus Breakpoint1 | 241 |
| Virus Breakpoint2 | 459 |
| Virus Gene Name | - |
| Virus Region Type | Surface |
| Integrated Virus Sequence | CAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCCTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAACTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATATTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGGT |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D