| Basic Information ▶ | |
| VISDB ID | TVIS10014890 |
|---|---|
| Fusion Name | HBV-chr4:q12 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | PCR and Sanger sequencing |
| Wet Assay | Yes |
| Sample ID | HKCI-11 |
| Sample Name | HKCI-11 |
| Sample Type | Cell line |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 24582836 |
| Journal | Cancer Cell |
| Published Year | 2014 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37.p10 |
| Human Genome RefSeq Accession | GCF_000001405.22 |
| Human Chromosome | chr4 |
| Cytogenetic Band | q12 |
| Human Strand | + |
| Human Integration Location Type | - |
| Hg19 Start | 53063790 |
| Hg19 End | 53063967 |
| Hg38 Start | 52197624 |
| Hg38 End | 52197801 |
| Junction Sequence | TTTTTAATTTTTTTGAGGCACAGTATCTCCATGTTGCCTAGCCTGGTCTCGAACTCCTGGGCTCAAGTGATCCTCCTGCCTTGGCTTCTGGAGTAGCTGGGACGACAGGTGAGTGCTACTGCACCTGGCTCTTCTTTTTTCATAATAGGGATAATAATAGTACTTCTAGATTGGTTG |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | - |
| Virus Genome Accession | NC_003977.1 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus, complete genome |
| Virus Genome Length | 3215 |
| Virus Breakpoint1 | 1805 |
| Virus Breakpoint2 | 1658 |
| Virus Gene Name | - |
| Virus Region Type | X |
| Integrated Virus Sequence | AGGACTCTTGGACTCTCAGCAATGTCAACGACCGACCTTGAGGCATACTTCAAAGACTGTTTGTTTAAAGACTGGGAGGAGTTGGGGGAGGAGATTAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGTTCAC |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D