| Basic Information ▶ | |
| VISDB ID | TVIS10016248 |
|---|---|
| Fusion Name | HBV-CAB39L integration |
| Validated | No |
| Curated Way | VISDB1.0 |
| Method | de novo assembly of RNA-seq reads |
| Wet Assay | No |
| Sample ID | 31656 |
| Sample Name | 31656N |
| Sample Type | Nontumor |
| Age | 45 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 22267523 |
| Journal | Genome Research |
| Published Year | 2012 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr13 |
| Cytogenetic Band | q14.2 |
| Human Strand | + |
| Human Integration Location Type | Intronic |
| Hg19 Start | 50003843 |
| Hg19 End | 50003928 |
| Hg38 Start | 49429707 |
| Hg38 End | 49429792 |
| Junction Sequence | caagtacctcgttgaattcttgcttatttagaatgaaataaaatgttctcttatagttttaatttgcatttatttgattacttgt |
| Target Gene ▶ | |
| Target Gene | CAB39L |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | - |
| Virus Genome Accession | NC_003977 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus (strain ayw) genome |
| Virus Genome Length | 3182 |
| Virus Breakpoint1 | 1798 |
| Virus Breakpoint2 | 1820 |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | GTCTGCGCACCAGCACCATGCAA |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000102547.20 |
| Gene Name | CAB39L |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000856912.1, Transcript 2: ENST00000856917.1, Transcript 3: ENST00000856920.1, Transcript 4: ENST00000856919.1, Transcript 5: ENST00000856916.1, Transcript 6: ENST00000856915.1, Transcript 7: ENST00000409308.6, Transcript 8: ENST00000856914.1, Transcript 9: ENST00000856913.1, Transcript 10: ENST00000856918.1, Transcript 11: ENST00000410043.5, Transcript 12: ENST00000965681.1, Transcript 13: ENST00000470410.1 |
| AlphaGenome Analysis | |
| Window | chr13:49364171-49495243 |
| RNA-seq Change (±2kb) | Mean: 0.000498086039442569 | Peak: 0.201171875 |
| ATAC Change (±2kb) | Mean: -0.0002908273017965257 | Peak: 0.6327693462371826 |
| Interpretation | RNA-seq: minimal change 3.0% | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -1.7% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D