| Basic Information ▶ | |
| VISDB ID | TVIS10017744 |
|---|---|
| Fusion Name | HBV-IGF2BP2 integration |
| Validated | No |
| Curated Way | VISDB1.0 |
| Method | Transcriptome Sequencing |
| Wet Assay | No |
| Sample ID | 228 |
| Sample Name | 228NT |
| Sample Type | Nontumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 26867494 |
| Journal | Journal of Hepatology |
| Published Year | 2016 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr3 |
| Cytogenetic Band | q27.2 |
| Human Strand | |
| Human Integration Location Type | Intronic |
| Hg19 Start | 185415449 |
| Hg19 End | 185415449 |
| Hg38 Start | 185697661 |
| Hg38 End | 185697661 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | IGF2BP2 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | B |
| Virus Genome Accession | DQ089769.1 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus isolate HK430, complete genome |
| Virus Genome Length | 3215 |
| Virus Breakpoint1 | 1826 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | core protein;X protein; |
| Integrated Virus Sequence | AGACTGGGAGGAGTTGGGGGAGGAGATTAGATTAAAGGTCTTTGTACTGGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATGCAACTTTTTC| |ACCTCTGCCTAATCATCTCATGTTCATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATTGACCCGTATAAAGAATT |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D