| Basic Information ▶ | |
| VISDB ID | TVIS10041407 |
|---|---|
| Fusion Name | HBV-LINC01837 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HBV capture sequencing |
| Wet Assay | Yes |
| Sample ID | 4232 |
| Sample Name | #04232T |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 33563643 |
| Journal | Gut |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr19 |
| Cytogenetic Band | q13.11 |
| Human Strand | |
| Human Integration Location Type | exonic |
| Hg19 Start | 32475920 |
| Hg19 End | 32475920 |
| Hg38 Start | 31985014 |
| Hg38 End | 31985014 |
| Junction Sequence | CAACCTCCTGTCCTGAGACA |
| Target Gene ▶ | |
| Target Gene | LINC01837, ENSG00000303073 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | HBV_D |
| Virus Genome Accession | X85254 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polymerase) |
| Virus Genome Length | 3182 bp |
| Virus Breakpoint1 | 346 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Transcript | Transcript 1: ENST00000636649.1, Transcript 2: ENST00000791260.1, Transcript 3: ENST00000654314.1, Transcript 4: ENST00000593082.3, Transcript 5: ENST00000654437.2, Transcript 6: ENST00000656360.2, Transcript 7: ENST00000663136.1, Transcript 8: ENST00000660926.2, Transcript 9: ENST00000791273.1, Transcript 10: ENST00000791274.1, Transcript 11: ENST00000791272.1, Transcript 12: ENST00000590021.2, Transcript 13: ENST00000791277.1, Transcript 14: ENST00000791275.1, Transcript 15: ENST00000791276.1, Transcript 16: ENST00000658221.1, Transcript 17: ENST00000590053.1, Transcript 18: ENST00000791279.1, Transcript 19: ENST00000669478.2, Transcript 20: ENST00000791280.1, Transcript 21: ENST00000791259.1, Transcript 22: ENST00000791572.1, Transcript 23: ENST00000791573.1 |
| Transcript 1 Gene Id | ENSG00000267489.6 |
| Transcript 1 Gene Name | LINC01837 |
| Transcript 1 Region | intron |
| Transcript 1 Impact | intronic_insertion |
| Transcript 2 Gene Id | ENSG00000267489.6 |
| Transcript 2 Gene Name | LINC01837 |
| Transcript 2 Region | intron |
| Transcript 2 Impact | intronic_insertion |
| Transcript 3 Gene Id | ENSG00000267489.6 |
| Transcript 3 Gene Name | LINC01837 |
| Transcript 3 Region | intron |
| Transcript 3 Impact | intronic_insertion |
| Transcript 4 Gene Id | ENSG00000267489.6 |
| Transcript 4 Gene Name | LINC01837 |
| Transcript 4 Region | intron |
| Transcript 4 Impact | intronic_insertion |
| Transcript 5 Gene Id | ENSG00000267489.6 |
| Transcript 5 Gene Name | LINC01837 |
| Transcript 5 Region | intron |
| Transcript 5 Impact | intronic_insertion |
| Transcript 6 Gene Id | ENSG00000267489.6 |
| Transcript 6 Gene Name | LINC01837 |
| Transcript 6 Region | intron |
| Transcript 6 Impact | intronic_insertion |
| Transcript 7 Gene Id | ENSG00000267489.6 |
| Transcript 7 Gene Name | LINC01837 |
| Transcript 7 Region | intron |
| Transcript 7 Impact | intronic_insertion |
| Transcript 8 Gene Id | ENSG00000267489.6 |
| Transcript 8 Gene Name | LINC01837 |
| Transcript 8 Region | intron |
| Transcript 8 Impact | intronic_insertion |
| Transcript 9 Gene Id | ENSG00000267489.6 |
| Transcript 9 Gene Name | LINC01837 |
| Transcript 9 Region | intron |
| Transcript 9 Impact | intronic_insertion |
| Transcript 10 Gene Id | ENSG00000267489.6 |
| Transcript 10 Gene Name | LINC01837 |
| Transcript 10 Region | intron |
| Transcript 10 Impact | intronic_insertion |
| Transcript 11 Gene Id | ENSG00000267489.6 |
| Transcript 11 Gene Name | LINC01837 |
| Transcript 11 Region | intron |
| Transcript 11 Impact | intronic_insertion |
| Transcript 12 Gene Id | ENSG00000267489.6 |
| Transcript 12 Gene Name | LINC01837 |
| Transcript 12 Region | intron |
| Transcript 12 Impact | intronic_insertion |
| Transcript 13 Gene Id | ENSG00000267489.6 |
| Transcript 13 Gene Name | LINC01837 |
| Transcript 13 Region | intron |
| Transcript 13 Impact | intronic_insertion |
| Transcript 14 Gene Id | ENSG00000267489.6 |
| Transcript 14 Gene Name | LINC01837 |
| Transcript 14 Region | intron |
| Transcript 14 Impact | intronic_insertion |
| Transcript 15 Gene Id | ENSG00000267489.6 |
| Transcript 15 Gene Name | LINC01837 |
| Transcript 15 Region | intron |
| Transcript 15 Impact | intronic_insertion |
| Transcript 16 Gene Id | ENSG00000267489.6 |
| Transcript 16 Gene Name | LINC01837 |
| Transcript 16 Region | intron |
| Transcript 16 Impact | intronic_insertion |
| Transcript 17 Gene Id | ENSG00000267489.6 |
| Transcript 17 Gene Name | LINC01837 |
| Transcript 17 Region | intron |
| Transcript 17 Impact | intronic_insertion |
| Transcript 18 Gene Id | ENSG00000267489.6 |
| Transcript 18 Gene Name | LINC01837 |
| Transcript 18 Region | intron |
| Transcript 18 Impact | intronic_insertion |
| Transcript 19 Gene Id | ENSG00000267489.6 |
| Transcript 19 Gene Name | LINC01837 |
| Transcript 19 Region | intron |
| Transcript 19 Impact | intronic_insertion |
| Transcript 20 Gene Id | ENSG00000267489.6 |
| Transcript 20 Gene Name | LINC01837 |
| Transcript 20 Region | intron |
| Transcript 20 Impact | intronic_insertion |
| Transcript 21 Gene Id | ENSG00000267489.6 |
| Transcript 21 Gene Name | LINC01837 |
| Transcript 21 Region | intron |
| Transcript 21 Impact | intronic_insertion |
| Transcript 22 Gene Id | ENSG00000303073.1 |
| Transcript 22 Gene Name | ENSG00000303073 |
| Transcript 22 Region | intron |
| Transcript 22 Impact | intronic_insertion |
| Transcript 23 Gene Id | ENSG00000303073.1 |
| Transcript 23 Gene Name | ENSG00000303073 |
| Transcript 23 Region | exon_non_coding |
| Transcript 23 Impact | noncoding_exon_insertion |
| AlphaGenome Analysis | |
| Chromosome | chr19 |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D