| Basic Information ▶ | |
| VISDB ID | TVIS10042890 |
|---|---|
| Fusion Name | HBV-ENSG00000283674 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HBV capture sequencing |
| Wet Assay | Yes |
| Sample ID | 80 |
| Sample Name | #080N |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | - |
| Disease Abbreviation | - |
| Cancer | - |
| Literature ▶ | |
| PubMed ID | 33563643 |
| Journal | Gut |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr8 |
| Cytogenetic Band | p23.1 |
| Human Strand | |
| Human Integration Location Type | intronic |
| Hg19 Start | 12508328 |
| Hg19 End | 12508328 |
| Hg38 Start | 12650819 |
| Hg38 End | 12650819 |
| Junction Sequence | GTGTCGGGAGGATCATGTTT |
| Target Gene ▶ | |
| Target Gene | ENSG00000283674 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | HBV_D |
| Virus Genome Accession | X85254 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polymerase) |
| Virus Genome Length | 3182 bp |
| Virus Breakpoint1 | 1782 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000283674.5 |
| Gene Name | ENSG00000283674 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000635775.1, Transcript 2: ENST00000745390.1, Transcript 3: ENST00000745400.1, Transcript 4: ENST00000637678.1, Transcript 5: ENST00000745404.1, Transcript 6: ENST00000745399.1, Transcript 7: ENST00000745401.1, Transcript 8: ENST00000745405.1, Transcript 9: ENST00000636990.2, Transcript 10: ENST00000745413.1, Transcript 11: ENST00000745411.1, Transcript 12: ENST00000745408.1, Transcript 13: ENST00000745407.1, Transcript 14: ENST00000745420.1, Transcript 15: ENST00000745421.1, Transcript 16: ENST00000745417.1, Transcript 17: ENST00000745416.1, Transcript 18: ENST00000745415.1, Transcript 19: ENST00000745414.1, Transcript 20: ENST00000745412.1, Transcript 21: ENST00000745410.1, Transcript 22: ENST00000745409.1, Transcript 23: ENST00000745406.1, Transcript 24: ENST00000745418.1 |
| AlphaGenome Analysis | |
| Window | chr8:12585283-12716355 |
| RNA-seq Change (±2kb) | Mean: 6.905382178956643e-05 | Peak: 0.041748046875 |
| ATAC Change (±2kb) | Mean: 3.0109574709058506e-06 | Peak: 0.5233569145202637 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: no signal in region (REF≈0, ALT≈0) |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D