| Basic Information ▶ | |
| VISDB ID | TVIS10043072 |
|---|---|
| Fusion Name | HBV-MYT1L integration |
| Validated | No |
| Curated Way | Curated |
| Method | HBV capture sequencing |
| Wet Assay | Yes |
| Sample ID | 80 |
| Sample Name | #080N |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | - |
| Disease Abbreviation | - |
| Cancer | - |
| Literature ▶ | |
| PubMed ID | 33563643 |
| Journal | Gut |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr2 |
| Cytogenetic Band | p25.3 |
| Human Strand | |
| Human Integration Location Type | intronic |
| Hg19 Start | 2149429 |
| Hg19 End | 2149429 |
| Hg38 Start | 2145657 |
| Hg38 End | 2145657 |
| Junction Sequence | ACACACACACACACAGAACA |
| Target Gene ▶ | |
| Target Gene | MYT1L |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | HBV_D |
| Virus Genome Accession | X85254 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polymerase) |
| Virus Genome Length | 3182 bp |
| Virus Breakpoint1 | 2605 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000186487.22 |
| Gene Name | MYT1L |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000647755.1, Transcript 2: ENST00000647738.2, Transcript 3: ENST00000644820.1, Transcript 4: ENST00000399161.8, Transcript 5: ENST00000648627.1, Transcript 6: ENST00000892482.1, Transcript 7: ENST00000648339.1, Transcript 8: ENST00000648928.1, Transcript 9: ENST00000648318.1, Transcript 10: ENST00000647618.1, Transcript 11: ENST00000650485.2, Transcript 12: ENST00000650560.1, Transcript 13: ENST00000648933.1, Transcript 14: ENST00000649207.1, Transcript 15: ENST00000647694.1, Transcript 16: ENST00000649663.1, Transcript 17: ENST00000648665.2, Transcript 18: ENST00000428368.7, Transcript 19: ENST00000648316.1, Transcript 20: ENST00000649810.1, Transcript 21: ENST00000650081.1, Transcript 22: ENST00000649641.2, Transcript 23: ENST00000649709.2, Transcript 24: ENST00000649313.2, Transcript 25: ENST00000647604.1, Transcript 26: ENST00000648148.1, Transcript 27: ENST00000479156.2, Transcript 28: ENST00000476547.2, Transcript 29: ENST00000649898.1, Transcript 30: ENST00000648568.1, Transcript 31: ENST00000647697.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.010 | Acceptor Loss: 0.010 | Donor Gain: 0.000 | Donor Loss: 0.000 |
| Delta Score Max | 0.010 |
| Delta Position at Max | -283 |
| Delta Score Flag | LOW |
| Gene | MYT1L |
| AlphaGenome Analysis | |
| Window | chr2:2080121-2211193 |
| RNA-seq Change (±2kb) | Mean: 7.57871093810536e-05 | Peak: 0.06640625 |
| ATAC Change (±2kb) | Mean: -0.00032778255990706384 | Peak: 3.95068359375 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -1.4% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D