| Basic Information ▶ | |
| VISDB ID | TVIS10043377 |
|---|---|
| Fusion Name | HBV-ENSG00000310047 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HBV capture sequencing |
| Wet Assay | Yes |
| Sample ID | 80 |
| Sample Name | #080N |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | - |
| Disease Abbreviation | - |
| Cancer | - |
| Literature ▶ | |
| PubMed ID | 33563643 |
| Journal | Gut |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr15 |
| Cytogenetic Band | q22.2 |
| Human Strand | |
| Human Integration Location Type | exonic |
| Hg19 Start | 61696398 |
| Hg19 End | 61696398 |
| Hg38 Start | 61404199 |
| Hg38 End | 61404199 |
| Junction Sequence | GCAATGGCATCATGACAGAG |
| Target Gene ▶ | |
| Target Gene | ENSG00000310047, ENSG00000259675 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | HBV_D |
| Virus Genome Accession | X85254 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polymerase) |
| Virus Genome Length | 3182 bp |
| Virus Breakpoint1 | 1819 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Transcript | Transcript 1: ENST00000559783.2, Transcript 2: ENST00000846750.1, Transcript 3: ENST00000846751.1, Transcript 4: ENST00000846752.1, Transcript 5: ENST00000846753.1 |
| Transcript 1 Gene Id | ENSG00000259675.5 |
| Transcript 1 Gene Name | ENSG00000259675 |
| Transcript 1 Region | intron |
| Transcript 1 Impact | intronic_insertion |
| Transcript 2 Gene Id | ENSG00000310047.1 |
| Transcript 2 Gene Name | ENSG00000310047 |
| Transcript 2 Region | exon_non_coding |
| Transcript 2 Impact | noncoding_exon_insertion |
| Transcript 3 Gene Id | ENSG00000310047.1 |
| Transcript 3 Gene Name | ENSG00000310047 |
| Transcript 3 Region | exon_non_coding |
| Transcript 3 Impact | noncoding_exon_insertion |
| Transcript 4 Gene Id | ENSG00000310047.1 |
| Transcript 4 Gene Name | ENSG00000310047 |
| Transcript 4 Region | exon_non_coding |
| Transcript 4 Impact | noncoding_exon_insertion |
| Transcript 5 Gene Id | ENSG00000310047.1 |
| Transcript 5 Gene Name | ENSG00000310047 |
| Transcript 5 Region | promoter |
| Transcript 5 Impact | promoter_insertion |
| AlphaGenome Analysis | |
| Window | chr15:61338663-61469735 |
| RNA-seq Change (±2kb) | Mean: 4.562746107694693e-05 | Peak: 0.038909912109375 |
| ATAC Change (±2kb) | Mean: 0.005077709909528494 | Peak: 8.578125 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: INCREASED 17.9% (REF=0.03, ALT=0.03) |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D